Search
Search
Optimize your experiments to get the best results. We’ve compiled a detailed knowledge base of the top tips and tricks to meet your research needs.
View the relevant questions below:
Having problems with your experiment? Visit our
MicroRNAs (miRNAs) are endogenous noncoding RNAs, ~22 nt in length, that play an important role in posttranscriptional gene regulation in animals and plants by targeting messenger RNA (mRNA) for degradation or translational repression. The miRNA precursors are transcribed from individual genes but are not translated into proteins. The primary transcript is processed in the nucleus to give one or more hairpin precursors that are exported to the cytoplasm. The mature miRNA is excised from the hairpin precursor. The mature miRNA is the biologically active form and regulates the expression of mRNA transcripts by binding to complementary sites on target mRNAs and inhibiting translation or, when there is perfect complementarity to the target sequence, inducing mRNA cleavage. In animals, translational repression, not transcript degradation, is the dominant miRNA mode of action. You can find more information here.
TaqMan® MicroRNA Assays employ a novel target-specific stem-loop reverse transcription primer to address the challenge of the short length of mature miRNA. The primer extends the 3' end of the target to produce a template that can be used in standard TaqMan® Assay–based real-time PCR. Also, the stem-loop structure in the tail of the primer confers a key advantage to these assays: specific detection of the mature, biologically active miRNA; it does not detect the precursor.
A TaqMan® MicroRNA Assay has two components: one tube containing a miRNA-specific stem-loop reverse transcription primer, and a separate tube with the specific TaqMan® miRNA Assay (forward primer, TaqMan® probe, and reverse primer). The stem-loop RT primer provides the specificity for the mature miRNA target; it does not detect its precursor. The formation of an RT primer/mature miRNA chimera extends the length of the 5’ end of the miRNA. The longer RT product provides a miRNA-specific cDNA template amenable to the TaqMan® assay design.
We are currently on miRBase v20. A complete list of assays can be found here.
You can search for and purchase TaqMan® MicroRNA Assays using our Assay Search Tool. This tool allows you to search for an assay based on assay ID, miRBase ID, miRBase accession number, and other parameters. The assays of interest can then be purchased directly from the results page using the “add to cart” function. For more information, view our video: Finding the Right TaqMan® MicroRNA Assay.
The average amplicon size for a TaqMan® MicroRNA Assay is less than 75 bp.
To find a candidate endogenous control, use our online search tool here. Select MicroRNA, control, and your target species, and then “Search”. From these candidates you can then choose which to order and test with your samples. For example, for human TaqMan® miRNA endogenous controls, the most common are for tissues: hsa-miR-26b, hsa-miR-92, hsa-miR-92N; miRNA for cell lines: hsa-miR-423, hsa-miR-374, hsa-miR-16; sn/snoRNAs: RNU48, RNU44, U47, RNU6B, or all four. Common mouse TaqMan® miRNA endogenous controls include snoRNA202 and snoRNA234.
The TaqMan® MicroRNA Assays can be used with the TaqMan® Universal PCR Master Mix; TaqMan® Universal PCR Master Mix, no AmpErase® UNG; TaqMan® Universal Master Mix II, no UNG; and TaqMan® Fast Advanced Master Mix.
The recommended input for TaqMan® MicroRNA Assays is 1–10 ng of total RNA. We recommend using total RNA, as we see better sensitivity (enriching for small RNA tends to result in the loss of rare but important miRNAs). If your particular microRNA is known to be a low expressor in your sample, you can try higher inputs (up to 250 ng total RNA).
Mass spectroscopy is run on each assay component (RT primer, TaqMan® forward and reverse primer, and TaqMan® probe) to ensure identity. Concentration is determined by A260 reading. Every assay is tested with a no-template control (NTC). We test for an NTC Ct of >38 for the miRNA assays ((-RT) NTC).
The TaqMan® MicroRNA Assays are meant to be used with the TaqMan® MicroRNA Reverse Transcription Kit. They can also be used with the High-Capacity cDNA Reverse Transcription Kit if needed, as this kit does not have the RT primer premixed with the other reagents.
When considering endogenous controls suitable for use with TaqMan® MicroRNA Assays, it is important that they share similar properties, such as RNA stability and size, and are amenable to the miRNA assay design. For this reason we recommend using another small RNA as a candidate control, as opposed to 18S or GAPDH, which will not go through the same RT process as the target microRNA. For more details, check our Application Note on endogenous controls for miRNAs.
Due to the design of the TaqMan® MicroRNA Assays, they will not amplify from gDNA. The stem-loop reverse transcription primer imposes steric hindrance such that it will not bind to the gDNA. The one exception is U6 (Assay ID 001973). This assay can detect gDNA because it has a linear reverse transcription primer, as the target sequence is larger than others. If you are using this assay, you will want to treat your sample with DNase.
Assay ID 000338 (ath-miR-159) can be used as a negative control, as it is not found in humans. Please check the assay details for full information if you plan to use it as a control for any other species.
Yes. If you are using individual TaqMan® MicroRNA Assays, you can prepare your own RT and PreAmp pools. Refer to Protocol for Creating Custom RT and Preamplification Pools using TaqMan® MicroRNA Assays, for detailed information. Although this protocol has been tested by our development group, we recommend that you validate the performance of the particular pool that you are interested in working with. At a minimum, we recommend running a no-template control (NTC). The NTC is crucial to identify any primer interactions that may increase the background.
Yes. Refer to Protocol for Creating Custom RT and Preamplification Pools using TaqMan® MicroRNA Assays, for detailed information. When pooling fewer than 12 assays together, you can reduce the final volume, but keep the final concentration of each assay in the pool at 0.2X (i.e., by diluting each 20X TaqMan® MicroRNA Assay 1:100). Preamplification was developed for use with small sample sizes as a means to “stretch” your sample. At the same time, the variability of the Ct value is reduced for low–copy number transcripts.
Small RNAs such as snRNAs or snoRNAs are usually not present in serum or other body fluids. Spike-in controls can be used to monitor sample preparation. Any miRNA that is present in your serum samples can be used as a control as long as it is stably expressed across all the sample types in your study. You can refer to the literature for candidate miRNAs to test, or you can select a control from your data set to use in your analysis.
You can submit your sequence for custom design using our online custom assay design tool. This can be used for TaqMan® Assay design for any small nucleic acid less than 200 bases long, including newly discovered miRNAs, piwi-interacting RNA (piRNA), small nuclear RNA (snRNA), and small nucleolar RNA (snoRNA).
No. We do not recommend using the TaqMan® Gene Expression Master Mix, as the assay specificity is reduced. Use the TaqMan® Universal Master Mix or the TaqMan® Fast Advanced Master Mix instead.
Deep sequencing analysis of mature miRNAs revealed that many miRNAs have either an addition or deletion of 1–3 bases at the 3’ and less frequently at the 5’ terminal end. These are often referred to as isomiRs. The sequence deposited in miRBase is the canonical sequence derived by aligning sequences from current deep sequencing data. Thus far, there has been no biological relevance attached to these different forms since they exclusively occur outside the seed sequence. For that reason, the changes detected in the expression level of one isomer are proportional to changes within the entire pool. As a result, there may be a shift in raw Ct value using assays targeting two separate isomiRs. However, the relative expression (∆∆Ct) has been demonstrated to be roughly the same. It should be noted that, although TaqMan® MicroRNA Assays are designed to be sequence-specific, they will detect a small spectrum of isomiRs. Depending on the number and composition at the 3’ end, an assay may detect the +1 and +2 isomiRs but not the –1 or –2 forms.
TaqMan Advanced miRNA Assay workflow has a universal RT and a universal pre-amplification step (miR-Amp). The first-generation TaqMan MicroRNA Assay workflow uses an miRNA-specific stem loop RT primer and has an optional pre-amplification step that is not built into the workflow but is sold separately. The main difference between these products is shown below:
TaqMan MicroRNA Assay:
- RT chemistry: Employs target-specific stem-loop primer during cDNA synthesis
- Pre-amplification: Not built into the workflow
- Throughput: Best for 1-10 targets
- Coverage: 205 species available; coverage for miRBase v21
- Format: Individual tubes, TaqMan array cards and plates, and OpenArray plates
TaqMan Advanced miRNA Assay:
- RT Chemistry: Employs a universal RT primer during cDNA synthesis
- Pre-amplification: Built into the workflow
- Throughput: Best for > 10 targets
- Coverage: Only human species is currently available; coverage for miRBase v21
- Format: Individual tubes, TaqMan array cards and plates, and OpenArray plates
miR-Amp is a 30-minute universal amplification that uses 14 cycles of PCR to provide a 3-10 Ct improvement in sensitivity (depending on sample type). mir-Amp uses universal primers that recognize regions of the cDNA outside of the miRNA target sequence. These sequences are added onto all mature miRNAs in the sample during the cDNA synthesis workflow.
We recommend using TaqMan™ Fast Advanced Master Mix, Cat. No. 4444557.
TaqMan™ Advanced miRNA Assay was validated with TaqMan™ Fast Advanced Master Mix (Cat. No, 4444557) and our claims are based on the results with it. There is no technical reason why TaqMan™ Gene Expression Master Mix and TaqMan™ Universal Master Mix wouldn't work. They may be slightly less sensitive and will take a longer time to run.
The miRNAs listed below are known to be expressed at relatively constant levels across many different tissue types. These miRNAs may work as good endogenous controls for your sample and experimental condition. However, one should validate these controls since there is no universal miRNA that works across all sample types and experimental conditions.
You cannot use U6 or snoRNA in the TaqMan™ Advanced miRNA Assay workflow. This is because these small RNAs lack the 5’ phosphate that is required for addition of the ligation adaptor.
The non-human miRNAs listed below can be used as exogenous (spike-in) controls to monitor extraction efficiency or sample input amount for difficult samples (e.g. serum/plasma, or other biofluids). The final concentration of the spike-in control in your test sample should be 1–10 pM. Spike-in controls must be 5’-phosphorylated.
We recommend using the TaqMan® Universal PCR Master Mix for the TaqMan® MicroRNA Arrays.
Our testing has shown that you can store either the RT pool of cDNA or the PreAmp product from the Megaplex™ reaction for at least 1 month at –20°C. As always, freeze thaw cycles should be kept to a minimum.
The thermal cycling step is included to increase RT efficiency. The RT pool is very complex (>380 primers) and the concentration of each primer is lower than in a single RT reaction, so we modified the protocol to optimize the reaction. We found that with custom pools of 96 or less, the reaction does not need cycling.

The microRNA targets represented in Pool A tend be better characterized, more broadly expressed, and/⁄or expressed at a higher level when compared to the Pool B.
The typical Ct cut-off on TaqMan Array Cards is 32, which is equivalent to Ct 35 on a plate (10 μl reaction). Previous studies show that if you use pre-amplification, a Ct cut-off of 29 or 30 can be used to reduce numbers of false positives (see Technical Note Optimized protocols for human or rodent microRNA profiling with precious samples). To ensure that you have selected a correct cut-off, you should run replicates of the same sample and use Ct cut-off before you see an increase in the Standard Deviation.
The turnaround time for our Custom TaqMan MicroRNA and Advanced miRNA Array cards configurable on the website is 4-6 weeks. Our Custom-plating cards available through our Custom Services team will ship in 8-10 weeks.
Due to the design of the nature of SYBR® Green binding, you will want to DNase-treat your samples to remove any potential contaminating gDNA.
The NCode™ SYBR® GreenER™ kits include a universal RT primer and a universal reverse qPCR primer. To design the forward qPCR primer, please follow the guidelines on p.13 of the manual.
When considering endogenous controls suitable for use with the NCode™ SYBR® GreenER™ system, it is important that they share similar properties, such as RNA stability and size, and are amenable to the miRNA assay design. For this reason we recommend using another small RNA as a candidate control, as opposed to 18S or GAPDH, which will not go through the same RT process as the target microRNA. For human and mouse samples, we have a short list of suggested primer designs you can try. Please keep in mind that you will still have to validate that these targets are stably expressed across your samples.
Ncode Normalizer Primer List
| Target Name | Forward Primer |
Human | |
RNT6B | ACGCAAATTCGTGAAGCGTTCCAT |
RNU19 | TGTGGAGTTGATCCTAGTCTGGGTG |
U54 | GGTACCTATTGTGTTGAGTAACGGTGA |
RNU49 | GCGATAACTGACGAAGACTACTCCTGTCTG |
5.8s | AGGACACATTGATCATCGACACTTCGA |
| |
Mouse |
|
snoRNA251 | ACTTAGACCAGAGGTCGATGATGAGAGC |
snoRNA55 | TGACGACTCCATGTGTCTGAGCAA |
snRNA429 | AGAATGACACCAACAAAGGAACCACTG |
snoRNA234 | GCGCGGAACTGAATCTAAGTGATTTAACAA |
snoRNA142 | ATGATGGGATTGAGGACCTGAGGAA |
We recommend that you use the same controls you would with our TaqMan® Gene Expression Assays, as the pri-miRNA assays do not use a stem-loop RT primer.
TaqMan® Pri-miRNA Assays are designed to detect the transcript that contains the targeted stem-loop. In some instances, e.g., when stem-loop sequences are clustered together and are transcribed on the same transcript, a TaqMan® Pri-miRNA Assay targeting one of the stem-loops will also detect the other stem-loops in the cluster.
These assays can be used with the High-Capacity RNA-to-cDNA™ Kit, or the SuperScript® VILO™ Master Mix, as both contain random primers needed for the reverse transcription.
For Research Use Only. Not for use in diagnostic procedures.