T7 Promoter Primer
Invitrogen™

T7 Promoter Primer

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter PrimerRead more
Catalog NumberQuantity
N560022 μg
Catalog number N56002
Price (JPY)
55,500
Each
Quantity:
2 μg

Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter Primer is recognized by T7 RNA polymerase and is commonly used to regulate gene expression of recombinant proteins. Subsequent recombinant proteins may be used for further downstream research applications.

T7 Promoter Primer features include:
• Desalted and purified by gel filtration
• Assayed for function by PCR amplification
• Provided in 2 μg quantity

Applications
• Sanger sequencing
• PCR amplification

T7 Primer Sequence: 5´- TAATACGACTCACTATAGGG- 3´

For Research Use Only. Not for use in diagnostic procedures.
Specifications
For Use With (Application)PCR Amplification
FormLyophilized
Primer Length20-mer
Primer Sequence5 ́d[TAATACGACTCACTATAGGG]3 ́
Product TypePrimer
Purification MethodGel-purified
Quantity2 μg
Shipping ConditionRoom Temperature
PrimerT7
PromoterT7
Unit SizeEach
Contents & Storage
• T7 Promoter Primer (2 μg)

Store in Freezer at –20°C.
Guaranteed stable for 6 months when properly stored.

Frequently asked questions (FAQs)

How is the T7 Promoter Primer (Cat. No. N56002) supplied?

It is a desalted primer supplied lyophilized in 10 mM Tris-HCl, pH 7.5, 1 mM EDTA

What is the sequence of the T7 Promoter Primer (Cat. No. N56002)?

Here is the sequence:

TAATACGACTCACTATAGGG