Hamburger Menu Button
Thermo Fisher Scientific Logo
Iniciar sesión
¿No tiene una cuenta? Crear una cuenta
  • Productos
    • Consumibles de laboratorio
    • Equipos de laboratorio
    • Instrumentos de Laboratorio
    • Clínica y Diagnóstico
    • Cromatografía
    • Espectrometría de Masas
    • Cultivo Celular
    • Análisis Celular
    • Anticuerpos
    • Ver todas las categorías de producto
  • Aplicaciones
    • Cultivo celular y transfección
    • Citometría de flujo
    • Investigación sobre el cáncer
    • Cromatografía
    • Secuenciación
    • PCR
    • Soluciones para laboratorio
    • Diagnóstico de alergias
    • Ver todas las aplicaciones y técnicas
  • Servicios
    • Servicios Personalizados
    • Servicios de Capacitación
    • Servicios para Empresas
    • Informática para laboratorios de ámbito empresarial
    • Servicios financieros y de arrendamiento
    • Servicios 360° de CDMO y CRO
    • Servicios de CDMO
    • Servicios de CRO
    • Ver todos los servicios
  • Ayuda y Soporte
    • Crear una nueva cuenta
    • Cómo hacer el pedido
    • Póngase en contacto con nosotros
    • Cambio de ubicación
    • Ver toda la ayuda y soporte técnico
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Ofertas especiales
  • Contáctenos
  • Orden Rápida
  • Documentos y certificados
Thermo Fisher Scientific Logo

Search

Buscar
Search button
          • Contáctenos
          • Orden Rápida
          • Iniciar sesión
            Iniciar sesión
            ¿No tiene una cuenta? Crear una cuenta
            • Cuenta
            • Pedidos
            • Productos y proyectos personalizados
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › Hs03302966_pri
          Assay Name:
          hsa-mir-181a-1
          Stem-loop ID:
          hsa-mir-181a-1
          Mapped to miRBase Version:
          v22.1
          Chromosome Location:
          Chr.1: 198859044 - 198859153 [-] on Build GRCh38
          Stem-loop Location:
          Chr.1: 198859044 - 198859153 [-] on Build GRCh38
          Mature miRNA ID:
          hsa-miR-181a-5p hsa-miR-181a-3p
          Species:
          Human
          Product Type:
          TaqMan™ Pri-miRNA Assay
          Assay ID Hs03302966_pri
          Size
          Availability Made To Order
          Catalog # 4427012
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Amplicon Length:

          72

          Chromosome Location:

          Chr. 1 - 198859348 - 198859348 [-] on 198859348 Build GRCh38

          Species:

          Human

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-181a-5p MIMAT0000256
          Human hsa-miR-181a-3p MIMAT0000270

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-181a-1
          Stem-loop Accession # MI0000289
          Stem-loop Sequence
          UGAGUUUUGAGGUUGCUUCAGUGAACAUUCAACGCUGUCGGUGAGUUUGGAAUUAAAAUCAAAACCAUCGACCGUUGAUUGUACCCUAUGGCUAACCAUCAUCUACUCCA
          Chromosome Location Chr. 1 - 198859044 - 198859153 [-] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0000256
          miRBase ID: hsa-miR-181a-5p
          Mature miRNA Sequence: AACAUUCAACGCUGUCGGUGAGU
          Chromosome Location: Chr. 1 - 198859044 - 198859153 [-] on Build GRCh38

          miRBase Accession #: MIMAT0000270
          miRBase ID: hsa-miR-181a-3p
          Mature miRNA Sequence: ACCAUCGACCGUUGAUUGUACC
          Chromosome Location: Chr. 1 - 198859044 - 198859153 [-] on Build GRCh38

          Gene Family ID MIPF0000007, mir-181
          Distance to Amplicon 159 bases

          Back To Top

          More Information




          Related Products

          Ambion® Anti-miR™ miRNA Inhibitor : AM10421
          Ambion® Pre-miR™ miRNA Precursor : PM10421
          TaqMan™ MicroRNA Assay : 000480
          mirVana® miRNA inhibitor : MH10421
          mirVana® miRNA mimic : MC10421
          TaqMan™ Advanced miRNA Assay : 477857_mir
          TaqMan™ Advanced miRNA Assay : rno481485_mir
          TaqMan™ Advanced miRNA Assay : mmu481485_mir
          Ambion® Anti-miR™ miRNA Inhibitor : AM10381
          Ambion® Pre-miR™ miRNA Precursor : PM10381
          TaqMan™ MicroRNA Assay : 000516
          mirVana® miRNA inhibitor : MH10381
          mirVana® miRNA mimic : MC10381
          TaqMan™ Advanced miRNA Assay : 479405_mir

          Back To Top

          Related Products

          • High Capacity RNA-to-cDNA Kit
          • SuperScript® IV VILO™ Master Mix
          • TaqMan® Universal PCR Master Mix
          • TaqMan® Fast Advanced Master Mix
          Pedidos Plus Icon Minus Icon
          • Estatus del pedido
          • Ayuda para pedidos
          • Orden Rápida
          • Supply Center
          • eProcurement
          Soporte Plus Icon Minus Icon
          • Ayuda y soporte
          • Entre en Contacto
          • Centros de asistencia técnica
          • Consultar documentos y certificados
          • Informar de un problema en la web
          Recursos Plus Icon Minus Icon
          • Centros de aprendizaje
          • Promociones
          • Eventos & Webinars
          • Medios Sociales
          Acerca de Thermo Fisher Plus Icon Minus Icon
          • Acerca de nosotros Acerca de nosotros
          • Empleo Empleo
          • Inversores Inversores
          • Noticias Noticias
          • Responsabilidad social Responsabilidad social
          • Marcas comerciales
          • Políticas y avisos
          Nuestro Portafolio Plus Icon Minus Icon
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Chile flag icon
          Chile

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-lq2bv:80/100.66.79.31:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0