Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_102099674_10
          See other PRMT7 GT Assays ›
          SNP ID:
          rs77805468
          Gene
          PRMT7 SLC7A6 SLC7A6OS
          Gene Name
          protein arginine methyltransferase 7
          solute carrier family 7 member 6
          solute carrier family 7 member 6 opposite strand
          Set Membership:
          -
          Chromosome Location:
          Chr.16: 68310421 - 68310421 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TGAAAGCCCGAGTTCCCGGCGGCTT[C/T]TGGGTTCCCCGGCGTGTACTCGGAC

          Assay ID C_102099674_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 610087 MIM: 605641

          Literature Links:

          PRMT7 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          PRMT7 - protein arginine methyltransferase 7
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001184824.1 424 Intron NP_001171753.1
          NM_001290018.1 424 Intron NP_001276947.1
          NM_019023.2 424 Intron NP_061896.1
          XM_011523112.2 424 Intron XP_011521414.1
          XM_011523113.2 424 Intron XP_011521415.1
          XM_011523115.2 424 Intron XP_011521417.1
          XM_011523116.2 424 Intron XP_011521418.1
          XM_011523121.2 424 Intron XP_011521423.1
          XM_011523124.2 424 Intron XP_011521426.1
          XM_011523125.2 424 Intron XP_011521427.1
          XM_011523126.2 424 Intron XP_011521428.1
          XM_011523128.2 424 Intron XP_011521430.1
          XM_011523131.2 424 Intron XP_011521433.1
          XM_017023290.1 424 Intron XP_016878779.1
          XM_017023291.1 424 Intron XP_016878780.1
          XM_017023292.1 424 Intron XP_016878781.1
          XM_017023293.1 424 Intron XP_016878782.1
          XM_017023294.1 424 Intron XP_016878783.1
          XM_017023295.1 424 Intron XP_016878784.1
          XM_017023296.1 424 Intron XP_016878785.1
          XM_017023297.1 424 Intron XP_016878786.1
          XM_017023298.1 424 Intron XP_016878787.1
          XM_017023299.1 424 Intron XP_016878788.1
          XM_017023300.1 424 Intron XP_016878789.1
          XM_017023301.1 424 Intron XP_016878790.1
          XM_017023302.1 424 Intron XP_016878791.1
          XM_017023303.1 424 Intron XP_016878792.1
          XM_017023304.1 424 Intron XP_016878793.1
          XM_017023305.1 424 Intron XP_016878794.1
          XM_017023306.1 424 Intron XP_016878795.1
          XM_017023307.1 424 Intron XP_016878796.1
          XM_017023308.1 424 Intron XP_016878797.1
          XM_017023309.1 424 Intron XP_016878798.1
          XM_017023310.1 424 Intron XP_016878799.1
          XM_017023311.1 424 Intron XP_016878800.1
          XM_017023312.1 424 Intron XP_016878801.1
          XM_017023313.1 424 Intron XP_016878802.1
          XM_017023314.1 424 Intron XP_016878803.1
          XM_017023315.1 424 Intron XP_016878804.1
          XM_017023316.1 424 Intron XP_016878805.1
          SLC7A6 - solute carrier family 7 member 6
          There are no transcripts associated with this gene.
          SLC7A6OS - solute carrier family 7 member 6 opposite strand
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_032178.2 424 Missense Mutation AAA,GAA K,E 129 NP_115554.2
          XM_011523372.2 424 Missense Mutation AAA,GAA K,E 129 XP_011521674.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          protein modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          spliceosomal snRNP assembly
          regulation of gene expression by genetic imprinting
          transcription, DNA-templated
          regulation of transcription, DNA-templated
          histone methylation
          peptidyl-arginine methylation
          peptidyl-arginine methylation, to symmetrical-dimethyl arginine
          peptidyl-arginine methylation, to asymmetrical-dimethyl arginine
          cell differentiation
          histone arginine methylation
          DNA methylation involved in gamete generation
          regulation of protein binding
          histone H4-R3 methylation
          hematopoietic progenitor cell differentiation
          protein transport
          histone-arginine N-methyltransferase activity
          S-adenosylmethionine-dependent methyltransferase activity
          protein-arginine N-methyltransferase activity
          [myelin basic protein]-arginine N-methyltransferase activity
          protein-arginine omega-N monomethyltransferase activity
          protein-arginine omega-N asymmetric methyltransferase activity
          protein-arginine omega-N symmetric methyltransferase activity
          histone binding
          ribonucleoprotein complex binding
          histone methyltransferase activity (H4-R3 specific)

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline