Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_102468139_10
          See other LILRB1 GT Assays ›
          SNP ID:
          rs79612392
          Gene
          LILRB1
          Gene Name
          leukocyte immunoglobulin like receptor B1
          Set Membership:
          -
          Chromosome Location:
          Chr.19: 54623275 - 54623275 on Build GRCh38
          Polymorphism:
          T/A, Transversion substitution
          Context Sequence [VIC/FAM]:

          CGTTGTGTATATGGCAAATTTCGAC[T/A]GTGAATCCATCTGTTCTTGGGCTTT

          Assay ID C_102468139_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 604811

          Literature Links:

          LILRB1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.02)
          (0.98)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.04)
          (0.96)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.03)
          (0.97)
          AMR
          A (0.02)
          (0.98)
          LILRB1 - leukocyte immunoglobulin like receptor B1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001081637.2 Intron NP_001075106.2
          NM_001081638.3 Intron NP_001075107.2
          NM_001081639.3 Intron NP_001075108.2
          NM_001278398.2 Intron NP_001265327.2
          NM_001278399.2 Intron NP_001265328.2
          NM_006669.6 Intron NP_006660.4
          XM_011526331.2 Intron XP_011524633.1
          XM_011526332.2 Intron XP_011524634.1
          XM_011526335.2 Intron XP_011524637.1
          XM_011526336.2 Intron XP_011524638.1
          XM_011526338.2 Intron XP_011524640.1
          XM_017026182.1 Intron XP_016881671.1
          XM_017026183.1 Intron XP_016881672.1
          XM_017026184.1 Intron XP_016881673.1
          XM_017026185.1 Intron XP_016881674.1
          XM_017026186.1 Intron XP_016881675.1
          XM_017026187.1 Intron XP_016881676.1
          XM_017026188.1 Intron XP_016881677.1
          XM_017026189.1 Intron XP_016881678.1
          XM_017026190.1 Intron XP_016881679.1
          XM_017026191.1 Intron XP_016881680.1
          XM_017026192.1 Intron XP_016881681.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          immunoglobulin receptor superfamily

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of T cell mediated cytotoxicity
          positive regulation of defense response to virus by host
          adaptive immune response
          T cell proliferation involved in immune response
          negative regulation of cytokine secretion involved in immune response
          immune response-inhibiting cell surface receptor signaling pathway
          Fc receptor mediated inhibitory signaling pathway
          signal transduction
          response to virus
          positive regulation of gene expression
          negative regulation of serotonin secretion
          receptor internalization
          interferon-gamma production
          negative regulation of interferon-gamma production
          negative regulation of mononuclear cell proliferation
          negative regulation of interferon-beta secretion
          negative regulation of T cell proliferation
          negative regulation of tumor necrosis factor biosynthetic process
          positive regulation of apoptotic process
          negative regulation of interferon-gamma biosynthetic process
          negative regulation of cell cycle
          negative regulation of endocytosis
          positive regulation of cytolysis
          positive regulation of transcription from RNA polymerase II promoter
          negative regulation of natural killer cell mediated cytotoxicity
          negative regulation of alpha-beta T cell activation
          regulation of immune response
          defense response to virus
          negative regulation of calcium ion transport
          cellular response to lipopolysaccharide
          interferon-gamma secretion
          dendritic cell differentiation
          negative regulation of dendritic cell apoptotic process
          negative regulation of interleukin-10 secretion
          negative regulation of interleukin-12 secretion
          negative regulation of CD8-positive, alpha-beta T cell activation
          negative regulation of T cell activation via T cell receptor contact with antigen bound to MHC molecule on antigen presenting cell
          positive regulation of gamma-delta T cell activation involved in immune response
          negative regulation of dendritic cell differentiation
          negative regulation of transforming growth factor-beta secretion
          negative regulation of osteoclast development
          protein phosphatase 1 binding
          HLA-A specific inhibitory MHC class I receptor activity
          HLA-B specific inhibitory MHC class I receptor activity
          MHC class I receptor activity
          SH2 domain binding
          MHC class I protein binding
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline