Search
LOADING 
- SNP ID:
- rs111636192
- Gene
-
REPIN1ZNF775 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.7: 150371224 - 150371224 on Build GRCh38
- Polymorphism:
- A/T, Transversion substitution
- Context Sequence [VIC/FAM]:
CTGGAGTGACTGTGCTTTTCCACCC[A/T]CAGCAGAGGAAGAACCGATGCTGGA
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|||||||||||||||||||||
Literature Links: |
REPIN1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| REPIN1 - replication initiator 1 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001099695.1 | 56 | Intron | NP_001093165.1 | |||
| NM_001099696.2 | 56 | Intron | NP_001093166.1 | |||
| NM_013400.3 | 56 | Intron | NP_037532.2 | |||
| NM_014374.3 | 56 | UTR 5 | NP_055189.2 | |||
| XM_005249985.1 | 56 | Intron | XP_005250042.1 | |||
| XM_006715947.3 | 56 | Intron | XP_006716010.1 | |||
| XM_006715948.3 | 56 | Intron | XP_006716011.1 | |||
| XM_006715949.3 | 56 | Intron | XP_006716012.1 | |||
| XM_006715950.3 | 56 | Intron | XP_006716013.1 | |||
| XM_006715951.2 | 56 | Intron | XP_006716014.1 | |||
| XM_006715952.2 | 56 | Intron | XP_006716015.1 | |||
| XM_006715953.2 | 56 | Intron | XP_006716016.1 | |||
| XM_011516112.1 | 56 | Intron | XP_011514414.1 | |||
| XM_017012081.1 | 56 | Intron | XP_016867570.1 | |||
| XM_017012082.1 | 56 | Intron | XP_016867571.1 | |||
| ZNF775 - zinc finger protein 775 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top