Search Thermo Fisher Scientific
Search Thermo Fisher Scientific
GTGCCGCAATACAGGAGGAGTTAGG[A/G]TACAACTGCCAGACTGGAGGAGTCA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 604526 MIM: 614155 MIM: 614154 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
IDH3B PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
IDH3B - isocitrate dehydrogenase 3 (NAD(+)) beta | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
MIR1292 - microRNA 1292 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
NOP56 - NOP56 ribonucleoprotein | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_006392.3 | Intron | NP_006383.2 |
SNORA51 - small nucleolar RNA, H/ACA box 51 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD110 - small nucleolar RNA, C/D box 110 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD56 - small nucleolar RNA, C/D box 56 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD57 - small nucleolar RNA, C/D box 57 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
SNORD86 - small nucleolar RNA, C/D box 86 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |