Search
LOADING 
- SNP ID:
- rs113143523
- Gene
-
DNAJC4FKBP2LOC105369340PLCB3PPP1R14BVEGFB - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.11: 64243838 - 64243838 on Build GRCh38
- Polymorphism:
- C/T, Transition substitution
- Context Sequence [VIC/FAM]:
TGACTGTTTCTTTGTGCATCTTCAA[C/T]AGGGTATGGAGAGCGGGGAGCTCCC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 604189
MIM: 186946
MIM: 600230
MIM: 601140
MIM: 601398
|
||||||||||||||||||||
Literature Links: |
DNAJC4 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| DNAJC4 - DnaJ heat shock protein family (Hsp40) member C4 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| FKBP2 - FK506 binding protein 2 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001135208.1 | Intron | NP_001128680.1 | ||||
| NM_004470.3 | Intron | NP_004461.2 | ||||
| NM_057092.2 | Intron | NP_476433.1 | ||||
| XM_005273848.3 | Intron | XP_005273905.1 | ||||
| LOC105369340 - uncharacterized LOC105369340 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| PLCB3 - phospholipase C beta 3 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| PPP1R14B - protein phosphatase 1 regulatory inhibitor subunit 14B | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_138689.2 | Intron | NP_619634.1 | ||||
| VEGFB - vascular endothelial growth factor B | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top