Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_164345152_10
          See other TSC2 GT Assays ›
          SNP ID:
          rs150178524
          Gene
          TSC2
          Gene Name
          tuberous sclerosis 2
          Set Membership:
          -
          Chromosome Location:
          Chr.16: 2074326 - 2074326 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CATCAAGGCGCTGCCTGTTCTGGTG[A/G]TGAAGCTCACGCACATCTCAGCCAC

          Assay ID C_164345152_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 191092

          Literature Links:

          TSC2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          TSC2 - tuberous sclerosis 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000548.4 2583 Missense Mutation ATG,GTG M,V 828 NP_000539.2
          NM_001077183.2 2583 Missense Mutation ATG,GTG M,V 828 NP_001070651.1
          NM_001114382.2 2583 Missense Mutation ATG,GTG M,V 828 NP_001107854.1
          NM_001318827.1 2583 Missense Mutation ATG,GTG M,V 791 NP_001305756.1
          NM_001318829.1 2583 Missense Mutation ATG,GTG M,V 779 NP_001305758.1
          NM_001318831.1 2583 Missense Mutation ATG,GTG M,V 628 NP_001305760.1
          NM_001318832.1 2583 Missense Mutation ATG,GTG M,V 839 NP_001305761.1
          XM_005255529.4 2583 Missense Mutation ATG,GTG M,V 828 XP_005255586.2
          XM_005255531.4 2583 Missense Mutation ATG,GTG M,V 828 XP_005255588.2
          XM_011522636.2 2583 Missense Mutation ATG,GTG M,V 828 XP_011520938.1
          XM_011522637.2 2583 Missense Mutation ATG,GTG M,V 828 XP_011520939.1
          XM_011522638.2 2583 Missense Mutation ATG,GTG M,V 882 XP_011520940.2
          XM_011522639.2 2583 Missense Mutation ATG,GTG M,V 828 XP_011520941.1
          XM_011522640.2 2583 Missense Mutation ATG,GTG M,V 828 XP_011520942.1
          XM_017023615.1 2583 Missense Mutation ATG,GTG M,V 828 XP_016879104.1
          XM_017023616.1 2583 Missense Mutation ATG,GTG M,V 828 XP_016879105.1
          XM_017023617.1 2583 Missense Mutation ATG,GTG M,V 882 XP_016879106.1
          XM_017023618.1 2583 Missense Mutation ATG,GTG M,V 380 XP_016879107.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          GTPase-activating protein

          Gene Ontology Categories:

          Function(s) Process(es)

          neural tube closure
          negative regulation of protein kinase activity
          protein import into nucleus
          endocytosis
          cell cycle arrest
          heart development
          protein localization
          negative regulation of cell proliferation
          negative regulation of phosphatidylinositol 3-kinase signaling
          viral process
          vesicle-mediated transport
          regulation of endocytosis
          negative regulation of Wnt signaling pathway
          negative regulation of TOR signaling
          protein kinase B signaling
          positive regulation of GTPase activity
          regulation of insulin receptor signaling pathway
          negative regulation of insulin receptor signaling pathway
          insulin-like growth factor receptor signaling pathway
          positive chemotaxis
          regulation of small GTPase mediated signal transduction
          regulation of cell cycle
          negative regulation of protein kinase B signaling
          GTPase activator activity
          protein binding
          phosphatase binding
          small GTPase binding
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline