Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_165628095_10
          See other MASP2 GT Assays ›
          SNP ID:
          rs80356718
          Gene
          MASP2 TARDBP
          Gene Name
          mannan binding lectin serine peptidase 2
          TAR DNA binding protein
          Set Membership:
          -
          Chromosome Location:
          Chr.1: 11022209 - 11022209 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AATGCCGAACCTAAGCACAATAGCA[A/G]TAGACAGTTAGAAAGAAGTGGAAGA

          Assay ID C_165628095_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          7 submissions

          Phenotype:

          MIM: 605102 MIM: 605078

          Literature Links:

          MASP2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.00)
          (1.00)
          AMR
          G (0.00)
          (1.00)
          MASP2 - mannan binding lectin serine peptidase 2
          There are no transcripts associated with this gene.
          TARDBP - TAR DNA binding protein
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_007375.3 922 Missense Mutation AAT,AGT N,S 267 NP_031401.1
          XM_017000863.1 922 Missense Mutation AAT,AGT N,S 267 XP_016856352.1
          XM_017000864.1 922 Missense Mutation AAT,AGT N,S 267 XP_016856353.1
          XM_017000865.1 922 Missense Mutation AAT,AGT N,S 267 XP_016856354.1
          XM_017000866.1 922 Missense Mutation AAT,AGT N,S 267 XP_016856355.1
          XM_017000867.1 922 Missense Mutation AAT,AGT N,S 267 XP_016856356.1
          XM_017000868.1 922 Missense Mutation AAT,AGT N,S 267 XP_016856357.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of protein phosphorylation
          transcription from RNA polymerase II promoter
          mRNA processing
          RNA splicing
          negative regulation of gene expression
          nuclear fragmentation involved in apoptotic nuclear change
          positive regulation of insulin secretion
          response to endoplasmic reticulum stress
          negative regulation by host of viral transcription
          positive regulation of transcription from RNA polymerase II promoter
          regulation of cell cycle
          3'-UTR-mediated mRNA stabilization
          nuclear inner membrane organization
          nucleotide binding
          transcriptional activator activity, RNA polymerase II distal enhancer sequence-specific binding
          double-stranded DNA binding
          transcription factor activity, sequence-specific DNA binding
          RNA binding
          mRNA 3'-UTR binding
          protein binding
          identical protein binding
          poly(A) RNA binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline