Search
Search

DDOST
KIF17
PINK1
PINK1-ASGCATTGGGTGGGGCTGTCTCGCCCA[C/T]CCGATGATGGGACACAGGCCCCACA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
3 submissions
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
DDOST PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| DDOST - dolichyl-diphosphooligosaccharide--protein glycosyltransferase non-catalytic subunit | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_005216.4 | 1089 | Missense Mutation | ATG,GTG | M,V 316 | NP_005207.2 | |
| KIF17 - kinesin family member 17 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| PINK1 - PTEN induced putative kinase 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| PINK1-AS - PINK1 antisense RNA | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||