Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_191673350_10
          See other PSMB8 GT Assays ›
          SNP ID:
          rs200753447
          Gene
          PSMB8 PSMB8-AS1 PSMB9 TAP1 TAP2
          Gene Name
          proteasome subunit beta 8
          PSMB8 antisense RNA 1 (head to head)
          proteasome subunit beta 9
          transporter 1, ATP binding cassette subfamily B member
          transporter 2, ATP binding cassette subfamily B member
          Set Membership:
          -
          Chromosome Location:
          Chr.6: 32845754 - 32845754 on Build GRCh38
          Polymorphism:
          C/G, Transversion substitution
          Context Sequence [VIC/FAM]:

          GATGAGAAGCACTGAGCGGGAGTAC[C/G]GCTCAGGGCTTTCGTACAGGAGCTG

          Assay ID C_191673350_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 177046 MIM: 177045 MIM: 170260 MIM: 170261

          Literature Links:

          PSMB8 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.01)
          (0.99)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          PSMB8 - proteasome subunit beta 8
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_004159.4 2407 Intron NP_004150.1
          NM_148919.3 2407 Intron NP_683720.2
          PSMB8-AS1 - PSMB8 antisense RNA 1 (head to head)
          There are no transcripts associated with this gene.
          PSMB9 - proteasome subunit beta 9
          There are no transcripts associated with this gene.
          TAP1 - transporter 1, ATP binding cassette subfamily B member
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000593.5 2407 Missense Mutation CCG,CGG P,R 751 NP_000584.2
          NM_001292022.1 2407 Missense Mutation CCG,CGG P,R 490 NP_001278951.1
          TAP2 - transporter 2, ATP binding cassette subfamily B member
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          protease ATP-binding cassette (ABC) transporter

          Gene Ontology Categories:

          Function(s) Process(es)

          MAPK cascade
          protein polyubiquitination
          stimulatory C-type lectin receptor signaling pathway
          antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent
          regulation of cellular amino acid metabolic process
          viral process
          anaphase-promoting complex-dependent catabolic process
          tumor necrosis factor-mediated signaling pathway
          NIK/NF-kappaB signaling
          Fc-epsilon receptor signaling pathway
          proteasome-mediated ubiquitin-dependent protein catabolic process
          regulation of mRNA stability
          fat cell differentiation
          T cell receptor signaling pathway
          negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle
          positive regulation of ubiquitin-protein ligase activity involved in regulation of mitotic cell cycle transition
          regulation of endopeptidase activity
          Wnt signaling pathway, planar cell polarity pathway
          type I interferon signaling pathway
          negative regulation of canonical Wnt signaling pathway
          positive regulation of canonical Wnt signaling pathway
          adaptive immune response
          antigen processing and presentation of peptide antigen via MHC class I
          antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent
          antigen processing and presentation of endogenous peptide antigen via MHC class I via ER pathway, TAP-dependent
          antigen processing and presentation of endogenous peptide antigen via MHC class Ib via ER pathway, TAP-dependent
          positive regulation of antigen processing and presentation of peptide antigen via MHC class I
          defense response
          peptide transport
          intracellular transport of viral protein in host cell
          antigen processing and presentation of endogenous peptide antigen via MHC class I
          protection from natural killer cell mediated cytotoxicity
          cytosol to ER transport
          transmembrane transport
          threonine-type endopeptidase activity
          protein binding
          ATP binding
          peptide transporter activity
          peptide-transporting ATPase activity
          MHC class Ib protein binding
          MHC class I protein binding
          peptide antigen binding
          ATPase activity, coupled to transmembrane movement of substances
          protein homodimerization activity
          ADP binding
          TAP1 binding
          TAP2 binding
          tapasin binding
          protein heterodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline