Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Unternehmensdienstleistungen
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_312451432_10
          See other R3HCC1L GT Assays ›
          SNP ID:
          rs369147340
          Gene
          R3HCC1L
          Gene Name
          R3H domain and coiled-coil containing 1 like
          Set Membership:
          -
          Chromosome Location:
          Chr.10: 98234447 - 98234447 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          TAAAATTGTTTTTTTGTGTTGCAGA[A/G]AGAAAGGATTTGATATTAAATGGGT

          Assay ID C_312451432_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          Literature Links:

          R3HCC1L PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          R3HCC1L - R3H domain and coiled-coil containing 1 like
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001256619.1 2355 Missense Mutation AAG,GAG K,E 669 NP_001243548.1
          NM_001256620.1 2355 Missense Mutation AAG,GAG K,E 655 NP_001243549.1
          NM_001256621.1 2355 Missense Mutation AAG,GAG K,E 61 NP_001243550.1
          NM_014472.4 2355 Missense Mutation AAG,GAG K,E 655 NP_055287.4
          NM_138469.2 2355 Missense Mutation AAG,GAG K,E 655 NP_612478.2
          XM_011539639.1 2355 Missense Mutation AAG,GAG K,E 676 XP_011537941.1
          XM_011539640.1 2355 Missense Mutation AAG,GAG K,E 669 XP_011537942.1
          XM_011539641.1 2355 Missense Mutation AAG,GAG K,E 669 XP_011537943.1
          XM_011539642.1 2355 Missense Mutation AAG,GAG K,E 669 XP_011537944.1
          XM_011539643.1 2355 Missense Mutation AAG,GAG K,E 669 XP_011537945.1
          XM_011539644.1 2355 Missense Mutation AAG,GAG K,E 669 XP_011537946.1
          XM_011539645.2 2355 Missense Mutation AAG,GAG K,E 669 XP_011537947.1
          XM_011539646.1 2355 Missense Mutation AAG,GAG K,E 669 XP_011537948.1
          XM_011539647.1 2355 Missense Mutation AAG,GAG K,E 669 XP_011537949.1
          XM_011539648.1 2355 Missense Mutation AAG,GAG K,E 669 XP_011537950.1
          XM_011539649.1 2355 Missense Mutation AAG,GAG K,E 662 XP_011537951.1
          XM_017016074.1 2355 Missense Mutation AAG,GAG K,E 669 XP_016871563.1
          XM_017016075.1 2355 Missense Mutation AAG,GAG K,E 655 XP_016871564.1
          XM_017016076.1 2355 Missense Mutation AAG,GAG K,E 655 XP_016871565.1
          XM_017016077.1 2355 Missense Mutation AAG,GAG K,E 655 XP_016871566.1
          XM_017016078.1 2355 Missense Mutation AAG,GAG K,E 655 XP_016871567.1
          XM_017016079.1 2355 Missense Mutation AAG,GAG K,E 655 XP_016871568.1
          XM_017016080.1 2355 Missense Mutation AAG,GAG K,E 655 XP_016871569.1
          XM_017016081.1 2355 Missense Mutation AAG,GAG K,E 655 XP_016871570.1
          XM_017016082.1 2355 Missense Mutation AAG,GAG K,E 655 XP_016871571.1
          XM_017016083.1 2355 Missense Mutation AAG,GAG K,E 655 XP_016871572.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Process(es)

          nucleotide binding
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-55ff9ddd88-qpt6f:80/100.66.79.31:80.
          git-commit: d366ff9721d93504b2ac26a183b2b3e3d0e7d9ec
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.42.0-2026.01.03-1.0