Search
Search

NAB2
NEMP1
STAT6GCGGAATTTCTCTTCCCTCGTCCCT[C/T]TCTGGCCGAGCACCCCCTCTCCCAG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
NAB2 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| NAB2 - NGFI-A binding protein 2 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| NEMP1 - nuclear envelope integral membrane protein 1 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001130963.1 | 77 | Intron | NP_001124435.1 | |||
| NM_015257.2 | 77 | Intron | NP_056072.2 | |||
| XM_011538056.2 | 77 | Intron | XP_011536358.1 | |||
| XM_011538057.2 | 77 | Intron | XP_011536359.1 | |||
| XM_011538058.2 | 77 | Intron | XP_011536360.1 | |||
| XM_011538059.1 | 77 | Intron | XP_011536361.1 | |||
| XM_011538060.2 | 77 | Intron | XP_011536362.1 | |||
| XM_017019077.1 | 77 | UTR 5 | XP_016874566.1 | |||
| XM_017019078.1 | 77 | Intron | XP_016874567.1 | |||
| XM_017019079.1 | 77 | Intron | XP_016874568.1 | |||
| STAT6 - signal transducer and activator of transcription 6 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||