Search
Search

DIO3
DIO3OS
MIR1247GCGCTCTGGTCCTCGACACCATGGC[C/G]AACTCCAGCAGCTCGGCCTATGGCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
DIO3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| DIO3 - deiodinase, iodothyronine, type III | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001362.3 | 887 | Silent Mutation | GCC,GCG | A,A 247 | NP_001353.4 | |
| DIO3OS - DIO3 opposite strand/antisense RNA (head to head) | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| MIR1247 - microRNA 1247 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||