Search
Search

C19orf45
PEX11G
ZNF358CTGCCTTGAGGTGTAAGAGGGTAAA[T/C]TGAGGCTGTGTTGGGGCTGCAGGCG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
C19orf45 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| C19orf45 - chromosome 19 open reading frame 45 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_198534.2 | Intron | NP_940936.2 | ||||
| XM_005272473.3 | Intron | XP_005272530.1 | ||||
| XM_011527993.1 | Intron | XP_011526295.1 | ||||
| XM_011527995.2 | Intron | XP_011526297.1 | ||||
| PEX11G - peroxisomal biogenesis factor 11 gamma | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| ZNF358 - zinc finger protein 358 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||