Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__16189191_10
          See other ACSS2 GT Assays ›
          SNP ID:
          rs2295096
          Gene
          ACSS2 GGT7
          Gene Name
          acyl-CoA synthetase short-chain family member 2
          gamma-glutamyltransferase 7
          Set Membership:
          -
          Chromosome Location:
          Chr.20: 34876907 - 34876907 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          GGGGGAGTCGGGGGCTCCCTTGGGA[A/G]GCTGAGGGGTGGGTGAGGAGATGGA

          Assay ID C__16189191_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605832 MIM: 612342

          Literature Links:

          ACSS2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.25)
          (0.75)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          G (0.30)
          (0.70)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          G (0.40)
          (0.60)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          G (0.20)
          (0.80)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          G (0.19)
          (0.81)
          AMR
          G (0.12)
          (0.88)
          ACSS2 - acyl-CoA synthetase short-chain family member 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001076552.2 Intron NP_001070020.2
          NM_001242393.1 Intron NP_001229322.1
          NM_018677.3 Intron NP_061147.1
          XM_005260455.1 Intron XP_005260512.1
          XM_005260456.1 Intron XP_005260513.1
          XM_006723826.1 Intron XP_006723889.1
          XM_011528905.1 Intron XP_011527207.1
          XM_011528906.1 Intron XP_011527208.1
          XM_011528907.1 Intron XP_011527209.1
          XM_011528908.1 Intron XP_011527210.1
          XM_011528909.2 Intron XP_011527211.1
          XM_011528911.1 Intron XP_011527213.1
          XM_011528912.2 Intron XP_011527214.1
          GGT7 - gamma-glutamyltransferase 7
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          ligase

          Gene Ontology Categories:

          Function(s) Process(es)

          ethanol oxidation
          lipid biosynthetic process
          acetate biosynthetic process
          acetyl-CoA biosynthetic process from acetate
          propionate biosynthetic process
          acetate-CoA ligase activity
          ATP binding
          AMP binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-fkn7b:80/100.66.79.246:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline