Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__16247973_10
          See other KANSL1 GT Assays ›
          SNP ID:
          rs2532234
          Gene
          KANSL1 KANSL1-AS1
          Gene Name
          KAT8 regulatory NSL complex subunit 1
          KANSL1 antisense RNA 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.17: 46194900 - 46194900 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AACATCTGCACCTAGGTTTCTGCGA[A/G]TTTCCATTTGTACTCCTAAAATCAC

          Assay ID C__16247973_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 612452

          Literature Links:

          KANSL1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU)
          C (0.21)
          (0.79)
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese)
          C (0.01)
          (0.99)
          EUR - Not Available
          AMR - Not Available
          KANSL1 - KAT8 regulatory NSL complex subunit 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001193465.1 Intron NP_001180394.1
          NM_001193466.1 Intron NP_001180395.1
          NM_015443.3 Intron NP_056258.1
          XM_006721823.1 Intron XP_006721886.1
          XM_006721824.3 Intron XP_006721887.1
          XM_011524628.2 Intron XP_011522930.1
          XM_011524629.2 Intron XP_011522931.1
          XM_011524630.2 Intron XP_011522932.1
          XM_011524631.2 Intron XP_011522933.1
          XM_011524632.2 Intron XP_011522934.1
          XM_017024488.1 Intron XP_016879977.1
          XM_017024489.1 Intron XP_016879978.1
          KANSL1-AS1 - KANSL1 antisense RNA 1
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          histone H4-K5 acetylation
          histone H4-K8 acetylation
          histone H4-K16 acetylation
          protein binding
          histone acetyltransferase activity (H4-K5 specific)
          histone acetyltransferase activity (H4-K8 specific)
          histone acetyltransferase activity (H4-K16 specific)

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-tr4x4:80/100.66.75.98:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline