Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__25940047_10
          See other MIR6717 GT Assays ›
          SNP ID:
          rs34978161
          Gene
          MIR6717 NDRG2 TPPP2
          Gene Name
          microRNA 6717
          NDRG family member 2
          tubulin polymerization promoting protein family member 2
          Set Membership:
          -
          Chromosome Location:
          Chr.14: 21017719 - 21017719 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          CAACGGATGCTGCACTGGTCAGAGA[A/G]GCTGTACGAGACCGGGACAGGCGAG

          Assay ID C__25940047_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 605272 MIM: 616956

          Literature Links:

          MIR6717 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          MIR6717 - microRNA 6717
          There are no transcripts associated with this gene.
          NDRG2 - NDRG family member 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001282211.1 1255 Silent Mutation GCC,GCT A,A 327 NP_001269140.1
          NM_001282212.1 1255 Silent Mutation GCC,GCT A,A 301 NP_001269141.1
          NM_001282213.1 1255 Silent Mutation GCC,GCT A,A 317 NP_001269142.1
          NM_001282214.1 1255 Silent Mutation GCC,GCT A,A 317 NP_001269143.1
          NM_001282215.1 1255 Silent Mutation GCC,GCT A,A 320 NP_001269144.1
          NM_001282216.1 1255 Silent Mutation GCC,GCT A,A 271 NP_001269145.1
          NM_001320329.1 1255 Silent Mutation GCC,GCT A,A 331 NP_001307258.1
          NM_016250.2 1255 Silent Mutation GCC,GCT A,A 317 NP_057334.1
          NM_201535.1 1255 Silent Mutation GCC,GCT A,A 331 NP_963293.1
          NM_201536.1 1255 Silent Mutation GCC,GCT A,A 317 NP_963294.1
          NM_201537.1 1255 Silent Mutation GCC,GCT A,A 331 NP_963831.1
          NM_201538.1 1255 Silent Mutation GCC,GCT A,A 317 NP_963832.1
          NM_201539.1 1255 Silent Mutation GCC,GCT A,A 331 NP_963833.1
          NM_201540.1 1255 Silent Mutation GCC,GCT A,A 331 NP_963834.1
          NM_201541.1 1255 Silent Mutation GCC,GCT A,A 317 NP_963835.1
          XM_011536996.2 1255 Silent Mutation GCC,GCT A,A 331 XP_011535298.1
          XM_011536997.1 1255 Silent Mutation GCC,GCT A,A 331 XP_011535299.1
          XM_011536998.1 1255 Silent Mutation GCC,GCT A,A 331 XP_011535300.1
          XM_011536999.1 1255 Silent Mutation GCC,GCT A,A 317 XP_011535301.1
          XM_011537001.1 1255 Silent Mutation GCC,GCT A,A 317 XP_011535303.1
          XM_011537002.1 1255 Silent Mutation GCC,GCT A,A 317 XP_011535304.1
          XM_017021480.1 1255 Silent Mutation GCC,GCT A,A 381 XP_016876969.1
          XM_017021481.1 1255 Silent Mutation GCC,GCT A,A 381 XP_016876970.1
          XM_017021482.1 1255 Silent Mutation GCC,GCT A,A 381 XP_016876971.1
          XM_017021483.1 1255 Silent Mutation GCC,GCT A,A 381 XP_016876972.1
          XM_017021484.1 1255 Silent Mutation GCC,GCT A,A 381 XP_016876973.1
          XM_017021485.1 1255 Silent Mutation GCC,GCT A,A 381 XP_016876974.1
          XM_017021486.1 1255 Silent Mutation GCC,GCT A,A 381 XP_016876975.1
          XM_017021487.1 1255 Silent Mutation GCC,GCT A,A 367 XP_016876976.1
          XM_017021488.1 1255 Silent Mutation GCC,GCT A,A 367 XP_016876977.1
          XM_017021489.1 1255 Silent Mutation GCC,GCT A,A 367 XP_016876978.1
          XM_017021490.1 1255 Silent Mutation GCC,GCT A,A 367 XP_016876979.1
          XM_017021491.1 1255 Silent Mutation GCC,GCT A,A 367 XP_016876980.1
          XM_017021492.1 1255 Silent Mutation GCC,GCT A,A 367 XP_016876981.1
          XM_017021493.1 1255 Silent Mutation GCC,GCT A,A 367 XP_016876982.1
          XM_017021494.1 1255 Silent Mutation GCC,GCT A,A 349 XP_016876983.1
          XM_017021495.1 1255 Silent Mutation GCC,GCT A,A 349 XP_016876984.1
          XM_017021496.1 1255 Silent Mutation GCC,GCT A,A 335 XP_016876985.1
          XM_017021497.1 1255 Silent Mutation GCC,GCT A,A 203 XP_016876986.1
          TPPP2 - tubulin polymerization promoting protein family member 2
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          serine protease

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of cytokine production
          signal transduction
          regulation of vascular endothelial growth factor production
          Wnt signaling pathway
          substantia nigra development
          cell differentiation
          negative regulation of smooth muscle cell proliferation
          negative regulation of ERK1 and ERK2 cascade
          regulation of platelet-derived growth factor production
          molecular_function
          protein binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline