Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__26220466_10
          See other CCDC125 GT Assays ›
          SNP ID:
          rs12656449
          Gene
          CCDC125 CDK7
          Gene Name
          coiled-coil domain containing 125
          cyclin dependent kinase 7
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.5: 69273660 - 69273660 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AAGACCTAGAATAACTTAGGGCAGA[A/G]CACTGTACAACACAGTGCAGTGATT

          Assay ID C__26220466_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 613781 MIM: 601955

          Literature Links:

          CCDC125 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.14)
          (0.86)
          Caucasian - Not Available CEPH (CEU)
          A (0.08)
          (0.92)
          EAS
          A (0.05)
          (0.95)
          African American - Not Available YRI (Yoruba)
          A (0.22)
          (0.78)
          SAS
          A (0.22)
          (0.78)
          Chinese - Not Available JPT (Japanese)
          A (0.06)
          (0.94)
          AFR
          A (0.21)
          (0.79)
          Japanese - Not Available CHB (Han Chinese)
          A (0.02)
          (0.98)
          EUR
          A (0.09)
          (0.91)
          AMR
          A (0.08)
          (0.92)
          CCDC125 - coiled-coil domain containing 125
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001297696.1 Intron NP_001284625.1
          NM_001297697.1 Intron NP_001284626.1
          NM_176816.4 Intron NP_789786.2
          XM_005248458.4 Intron XP_005248515.1
          XM_005248459.4 Intron XP_005248516.1
          XM_005248461.3 Intron XP_005248518.1
          XM_005248463.3 Intron XP_005248520.1
          XM_005248464.3 Intron XP_005248521.1
          XM_006714569.3 Intron XP_006714632.1
          XM_006714570.3 Intron XP_006714633.1
          XM_011543255.2 Intron XP_011541557.1
          XM_011543256.2 Intron XP_011541558.1
          XM_011543257.2 Intron XP_011541559.1
          XM_011543258.2 Intron XP_011541560.1
          XM_011543259.2 Intron XP_011541561.1
          XM_011543260.2 Intron XP_011541562.1
          XM_017009206.1 Intron XP_016864695.1
          XM_017009207.1 Intron XP_016864696.1
          XM_017009208.1 Intron XP_016864697.1
          XM_017009209.1 Intron XP_016864698.1
          XM_017009210.1 Intron XP_016864699.1
          XM_017009211.1 Intron XP_016864700.1
          CDK7 - cyclin dependent kinase 7
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001324069.1 Intron NP_001310998.1
          NM_001324070.1 Intron NP_001310999.1
          NM_001324071.1 Intron NP_001311000.1
          NM_001324072.1 Intron NP_001311001.1
          NM_001324074.1 Intron NP_001311003.1
          NM_001324075.1 Intron NP_001311004.1
          NM_001324077.1 Intron NP_001311006.1
          NM_001324078.1 Intron NP_001311007.1
          NM_001799.3 Intron NP_001790.1
          XM_011543094.2 Intron XP_011541396.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          non-receptor serine/threonine protein kinase

          Gene Ontology Categories:

          Function(s) Process(es)

          regulation of cyclin-dependent protein serine/threonine kinase activity
          G1/S transition of mitotic cell cycle
          G2/M transition of mitotic cell cycle
          transcription-coupled nucleotide-excision repair
          nucleotide-excision repair, preincision complex assembly
          transcription initiation from RNA polymerase I promoter
          transcription elongation from RNA polymerase I promoter
          termination of RNA polymerase I transcription
          transcription from RNA polymerase II promoter
          transcription initiation from RNA polymerase II promoter
          transcription elongation from RNA polymerase II promoter
          7-methylguanosine mRNA capping
          protein phosphorylation
          cell cycle arrest
          cell proliferation
          androgen receptor signaling pathway
          snRNA transcription from RNA polymerase II promoter
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          cell division
          transcription coactivator activity
          protein kinase activity
          protein serine/threonine kinase activity
          cyclin-dependent protein serine/threonine kinase activity
          protein binding
          ATP binding
          protein C-terminus binding
          DNA-dependent ATPase activity
          RNA polymerase II carboxy-terminal domain kinase activity
          kinase activity
          androgen receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline