Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__30097088_10
          See other GDNF GT Assays ›
          SNP ID:
          rs9292675
          Gene
          GDNF GDNF-AS1
          Gene Name
          glial cell derived neurotrophic factor
          GDNF antisense RNA 1 (head to head)
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.5: 37832303 - 37832303 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          ACATAAGCCTTAACCAGTTGCACCA[C/T]GTACAGTGCAGGATATAAATGTCAG

          Assay ID C__30097088_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 600837

          Literature Links:

          GDNF PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          C (0.01)
          (0.99)
          Caucasian - Not Available CEPH (CEU)
          C (0.00)
          (1.00)
          EAS
          C (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba)
          C (0.08)
          (0.92)
          SAS
          C (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          C (0.05)
          (0.95)
          Japanese - Not Available JPT (Japanese)
          C (0.01)
          (0.99)
          EUR
          C (0.00)
          (1.00)
          AMR
          C (0.01)
          (0.99)
          GDNF - glial cell derived neurotrophic factor
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000514.3 Intron NP_000505.1
          NM_001190468.1 Intron NP_001177397.1
          NM_001190469.1 Intron NP_001177398.1
          NM_001278098.1 Intron NP_001265027.1
          NM_199231.2 Intron NP_954701.1
          XM_011514030.2 Intron XP_011512332.1
          XM_017009337.1 Intron XP_016864826.1
          GDNF-AS1 - GDNF antisense RNA 1 (head to head)
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          neurotrophic factor

          Gene Ontology Categories:

          Function(s) Process(es)

          MAPK cascade
          metanephros development
          branching involved in ureteric bud morphogenesis
          neural crest cell migration
          organ induction
          postsynaptic membrane organization
          mesenchymal to epithelial transition involved in metanephros morphogenesis
          signal transduction
          nervous system development
          positive regulation of cell proliferation
          adult locomotory behavior
          regulation of gene expression
          postganglionic parasympathetic fiber development
          peristalsis
          neuron projection development
          positive regulation of monooxygenase activity
          positive regulation of dopamine secretion
          negative regulation of apoptotic process
          negative regulation of neuron apoptotic process
          positive regulation of GTPase activity
          positive regulation of cell differentiation
          positive regulation of transcription from RNA polymerase II promoter
          mRNA stabilization
          enteric nervous system development
          sympathetic nervous system development
          regulation of dopamine uptake involved in synaptic transmission
          ureteric bud formation
          regulation of morphogenesis of a branching structure
          positive regulation of ureteric bud formation
          positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis
          positive regulation of branching involved in ureteric bud morphogenesis
          regulation of stem cell differentiation
          negative regulation of extrinsic apoptotic signaling pathway in absence of ligand
          Ras guanyl-nucleotide exchange factor activity
          receptor binding
          protein binding
          growth factor activity
          protein homodimerization activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline