Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__31846702_10
          See other NCOA1 GT Assays ›
          SNP ID:
          rs12478071
          Gene
          NCOA1
          Gene Name
          nuclear receptor coactivator 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.2: 24500875 - 24500875 on Build GRCh38
          Polymorphism:
          A/G, Transition substitution
          Context Sequence [VIC/FAM]:

          AACAACAAAAAATTTAATGCTGTAG[A/G]GAAAGGATATTGAAAATGGATATTT

          Assay ID C__31846702_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602691

          Literature Links:

          NCOA1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          G (0.34)
          (0.66)
          Caucasian - Not Available CEPH (CEU)
          G (0.23)
          (0.77)
          EAS
          G (0.13)
          (0.87)
          African American - Not Available YRI (Yoruba)
          A (0.22)
          (0.78)
          SAS
          G (0.26)
          (0.74)
          Chinese - Not Available JPT (Japanese)
          G (0.23)
          (0.77)
          AFR
          A (0.29)
          (0.71)
          Japanese - Not Available CHB (Han Chinese)
          G (0.10)
          (0.90)
          EUR
          G (0.24)
          (0.76)
          AMR
          G (0.21)
          (0.79)
          NCOA1 - nuclear receptor coactivator 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_003743.4 Intron NP_003734.3
          NM_147223.2 Intron NP_671756.1
          NM_147233.2 Intron NP_671766.1
          XM_005264625.1 Intron XP_005264682.1
          XM_005264626.1 Intron XP_005264683.1
          XM_005264628.1 Intron XP_005264685.1
          XM_017005168.1 Intron XP_016860657.1
          XM_017005169.1 Intron XP_016860658.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Panther Classification:

          Molecular Function -

          histone modifying enzyme

          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of transcription from RNA polymerase II promoter by galactose
          regulation of thyroid hormone mediated signaling pathway
          transcription, DNA-templated
          lactation
          male gonad development
          bile acid and bile salt transport
          cerebellum development
          hippocampus development
          hypothalamus development
          cerebral cortex development
          androgen receptor signaling pathway
          intracellular receptor signaling pathway
          response to estradiol
          response to retinoic acid
          response to progesterone
          cellular response to hormone stimulus
          positive regulation of apoptotic process
          histone H4 acetylation
          cellular lipid metabolic process
          estrous cycle
          positive regulation of neuron differentiation
          positive regulation of transcription, DNA-templated
          positive regulation of female receptivity
          positive regulation of transcription from RNA polymerase II promoter
          male mating behavior
          labyrinthine layer morphogenesis
          cellular response to Thyroglobulin triiodothyronine
          regulation of cellular response to drug
          RNA polymerase II regulatory region DNA binding
          RNA polymerase II transcription coactivator activity
          chromatin binding
          transcription coactivator activity
          histone acetyltransferase activity
          protein binding
          ligand-dependent nuclear receptor binding
          enzyme binding
          estrogen receptor binding
          ligand-dependent nuclear receptor transcription coactivator activity
          protein complex binding
          progesterone receptor binding
          nuclear hormone receptor binding
          retinoid X receptor binding
          protein dimerization activity
          protein N-terminus binding
          androgen receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline