Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__60103696_10
          See other LIPC GT Assays ›
          SNP ID:
          rs34596532
          Gene
          LIPC
          Gene Name
          lipase C, hepatic type
          Set Membership:
          -
          Chromosome Location:
          Chr.15: 58568742 - 58568742 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          ATGACATTTTGTTCAGAAAACACAG[A/T]TGACCTACTACTTCGCCCAACCCAG

          Assay ID C__60103696_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 151670

          Literature Links:

          LIPC PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          LIPC - lipase C, hepatic type
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_000236.2 1417 Missense Mutation GAT,GTT D,V 472 NP_000227.2
          XM_005254372.1 1417 Missense Mutation GAT,GTT D,V 472 XP_005254429.1
          XM_005254374.4 1417 Missense Mutation GAT,GTT D,V 484 XP_005254431.2
          XM_006720502.3 1417 Missense Mutation GAT,GTT D,V 425 XP_006720565.1
          XM_017022176.1 1417 Intron XP_016877665.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          lipase

          Gene Ontology Categories:

          Function(s) Process(es)

          response to hypoxia
          liver development
          fatty acid biosynthetic process
          phosphatidylserine metabolic process
          circadian rhythm
          cholesterol metabolic process
          response to carbohydrate
          response to acetate
          heparan sulfate proteoglycan biosynthetic process
          triglyceride catabolic process
          response to nutrient levels
          response to magnesium ion
          cellular response to hormone stimulus
          chylomicron remodeling
          very-low-density lipoprotein particle remodeling
          intermediate-density lipoprotein particle remodeling
          low-density lipoprotein particle remodeling
          high-density lipoprotein particle remodeling
          chylomicron remnant clearance
          low-density lipoprotein particle clearance
          phosphatidylcholine catabolic process
          response to drug
          cholesterol homeostasis
          response to amino acid
          response to peptide hormone
          reverse cholesterol transport
          lipid digestion
          phosphatidylethanolamine metabolic process
          phosphatidic acid metabolic process
          glycerophospholipid catabolic process
          response to copper ion
          developmental growth
          protein oligomerization
          response to glucocorticoid
          response to calcium ion
          triglyceride homeostasis
          response to fatty acid
          phospholipase activity
          lysophospholipase activity
          triglyceride lipase activity
          heparin binding
          lipid binding
          phosphatidylcholine 1-acylhydrolase activity
          transferase activity, transferring acyl groups
          low-density lipoprotein particle binding
          apolipoprotein binding
          heparan sulfate proteoglycan binding
          acylglycerol lipase activity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline