Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C__86320901_10
          See other MAGI2 GT Assays ›
          SNP ID:
          rs41435246
          Gene
          MAGI2 MAGI2-AS2
          Gene Name
          membrane associated guanylate kinase, WW and PDZ domain containing 2
          MAGI2 antisense RNA 2
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.7: 79010481 - 79010481 on Build GRCh38
          Polymorphism:
          G/A, Transition substitution
          Context Sequence [VIC/FAM]:

          GCTAAAAAATACAGAGTTCTAAAAA[G/A]TGTACAATAAATGTTATCTATTGTT

          Assay ID C__86320901_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 606382

          Literature Links:

          MAGI2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.04)
          (0.96)
          Caucasian - Not Available CEPH (CEU)
          A (0.10)
          (0.90)
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba)
          A (0.03)
          (0.97)
          SAS
          A (0.06)
          (0.94)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.05)
          (0.95)
          Japanese - Not Available JPT (Japanese)
          A (0.01)
          (0.99)
          EUR
          A (0.07)
          (0.93)
          AMR
          A (0.03)
          (0.97)
          MAGI2 - membrane associated guanylate kinase, WW and PDZ domain containing 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001301128.1 Intron NP_001288057.1
          NM_012301.3 Intron NP_036433.2
          XM_011516718.1 Intron XP_011515020.1
          XM_011516719.2 Intron XP_011515021.1
          XM_011516720.2 Intron XP_011515022.1
          XM_011516726.2 Intron XP_011515028.1
          XM_011516728.1 Intron XP_011515030.1
          XM_017012840.1 Intron XP_016868329.1
          XM_017012841.1 Intron XP_016868330.1
          XM_017012842.1 Intron XP_016868331.1
          XM_017012843.1 Intron XP_016868332.1
          XM_017012844.1 Intron XP_016868333.1
          XM_017012845.1 Intron XP_016868334.1
          XM_017012846.1 Intron XP_016868335.1
          XM_017012847.1 Intron XP_016868336.1
          XM_017012848.1 Intron XP_016868337.1
          XM_017012849.1 Intron XP_016868338.1
          XM_017012850.1 Intron XP_016868339.1
          XM_017012851.1 Intron XP_016868340.1
          XM_017012852.1 Intron XP_016868341.1
          MAGI2-AS2 - MAGI2 antisense RNA 2
          There are no transcripts associated with this gene.

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          positive regulation of receptor internalization
          planar cell polarity pathway involved in axis elongation
          negative regulation of cell proliferation
          positive regulation of neuron projection development
          negative regulation of cell migration
          positive regulation of phosphoprotein phosphatase activity
          negative regulation of activin receptor signaling pathway
          nerve growth factor signaling pathway
          receptor clustering
          protein heterooligomerization
          negative regulation of protein kinase B signaling
          SMAD protein signal transduction
          mitotic cell cycle arrest
          glomerular visceral epithelial cell development
          neuroligin clustering involved in postsynaptic membrane assembly
          cellular response to nerve growth factor stimulus
          positive regulation of synaptic vesicle clustering
          signal transducer activity
          protein binding
          phosphatase binding
          receptor signaling complex scaffold activity
          beta-1 adrenergic receptor binding
          SMAD binding
          type II activin receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline