Search
Search

FBF1
MRPL38
TRIM65TCCCCTGAGAAGGCTTACCTGTGCG[A/G]AGGCGGGCAGCCCGCTCCTCTTCCA
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
|
||||||||||||||||||||
Literature Links: |
FBF1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| FBF1 - Fas binding factor 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| MRPL38 - mitochondrial ribosomal protein L38 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_032478.3 | 600 | Silent Mutation | CTC,CTT | L,L 125 | NP_115867.2 | |
| TRIM65 - tripartite motif containing 65 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||