Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C___2533058_20
          See other ERCC1 GT Assays ›
          SNP ID:
          rs2282696
          Gene
          ERCC1 FOSB
          Gene Name
          ERCC excision repair 1, endonuclease non-catalytic subunit
          FosB proto-oncogene, AP-1 transcription factor subunit
          Set Membership:
          -
          Chromosome Location:
          Chr.19: 45468781 - 45468781 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          TTTAAGTCAAGGGTGAAAAGAATAA[A/C]CCCCAACCCCCACAAAAAGGCGCAT

          Assay ID C___2533058_20
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 126380 MIM: 164772

          Literature Links:

          ERCC1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.37)
          (0.63)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.34)
          (0.66)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.33)
          (0.67)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.25)
          (0.75)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          C (0.47)
          (0.53)
          AMR
          A (0.47)
          (0.53)
          ERCC1 - ERCC excision repair 1, endonuclease non-catalytic subunit
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001166049.1 Intron NP_001159521.1
          NM_001983.3 Intron NP_001974.1
          NM_202001.2 Intron NP_973730.1
          XM_005258634.1 Intron XP_005258691.1
          XM_005258635.2 Intron XP_005258692.1
          XM_005258636.4 Intron XP_005258693.1
          XM_005258637.1 Intron XP_005258694.1
          XM_011526610.2 Intron XP_011524912.1
          XM_017026459.1 Intron XP_016881948.1
          XM_017026460.1 Intron XP_016881949.1
          XM_017026461.1 Intron XP_016881950.1
          XM_017026462.1 Intron XP_016881951.1
          XM_017026463.1 Intron XP_016881952.1
          XM_017026464.1 Intron XP_016881953.1
          XM_017026465.1 Intron XP_016881954.1
          XM_017026466.1 Intron XP_016881955.1
          FOSB - FosB proto-oncogene, AP-1 transcription factor subunit
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001114171.1 Intron NP_001107643.1
          NM_006732.2 Intron NP_006723.2
          XM_005258691.1 Intron XP_005258748.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          endodeoxyribonuclease basic leucine zipper transcription factor

          Gene Ontology Categories:

          Function(s) Process(es)

          pyrimidine dimer repair by nucleotide-excision repair
          replicative cell aging
          DNA repair
          transcription-coupled nucleotide-excision repair
          nucleotide-excision repair
          nucleotide-excision repair, preincision complex stabilization
          nucleotide-excision repair, DNA incision, 3'-to lesion
          nucleotide-excision repair, DNA incision, 5'-to lesion
          double-strand break repair
          DNA recombination
          mitotic recombination
          syncytium formation
          response to oxidative stress
          spermatogenesis
          response to nutrient
          cell proliferation
          male gonad development
          UV protection
          response to sucrose
          response to X-ray
          multicellular organism aging
          negative regulation of telomere maintenance
          nucleotide-excision repair, DNA incision
          post-embryonic hemopoiesis
          multicellular organism growth
          interstrand cross-link repair
          isotype switching
          oogenesis
          embryonic organ development
          global genome nucleotide-excision repair
          t-circle formation
          positive regulation of t-circle formation
          negative regulation of transcription from RNA polymerase II promoter
          transcription from RNA polymerase II promoter
          female pregnancy
          response to mechanical stimulus
          response to progesterone
          cellular response to hormone stimulus
          response to drug
          response to morphine
          positive regulation of transcription from RNA polymerase II promoter
          response to corticosterone
          response to cAMP
          cellular response to calcium ion
          single-stranded DNA endodeoxyribonuclease activity
          TFIID-class transcription factor binding
          damaged DNA binding
          single-stranded DNA binding
          protein binding
          protein C-terminus binding
          protein domain specific binding
          structure-specific DNA binding
          RNA polymerase II core promoter proximal region sequence-specific DNA binding
          transcription factor activity, RNA polymerase II core promoter proximal region sequence-specific binding
          transcriptional activator activity, RNA polymerase II core promoter proximal region sequence-specific binding
          DNA binding
          transcription factor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-8dsbr:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline