Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C____446786_10
          See other ASAP2 GT Assays ›
          SNP ID:
          rs10929580
          Gene
          ASAP2 ITGB1BP1
          Gene Name
          ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
          integrin subunit beta 1 binding protein 1
          Set Membership:
          > HapMap
          Chromosome Location:
          Chr.2: 9407234 - 9407234 on Build GRCh38
          Polymorphism:
          A/C, Transversion substitution
          Context Sequence [VIC/FAM]:

          GCTGCTTTGTTTACCTTTTAAATCC[A/C]GGCACAAGCGAGTGCTGCCACTGGC

          Assay ID C____446786_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 603817 MIM: 607153

          Literature Links:

          ASAP2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.35)
          (0.65)
          Caucasian - Not Available CEPH (CEU)
          C (0.46)
          (0.54)
          EAS
          A (0.05)
          (0.95)
          African American - Not Available YRI (Yoruba)
          A (0.42)
          (0.58)
          SAS
          A (0.39)
          (0.61)
          Chinese - Not Available JPT (Japanese)
          A (0.01)
          (0.99)
          AFR
          A (0.37)
          (0.63)
          Japanese - Not Available CHB (Han Chinese)
          A (0.06)
          (0.94)
          EUR
          C (0.43)
          (0.57)
          AMR
          A (0.36)
          (0.64)
          ASAP2 - ArfGAP with SH3 domain, ankyrin repeat and PH domain 2
          There are no transcripts associated with this gene.
          ITGB1BP1 - integrin subunit beta 1 binding protein 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001319066.1 Intron NP_001305995.1
          NM_001319067.1 Intron NP_001305996.1
          NM_001319068.1 Intron NP_001305997.1
          NM_001319069.1 Intron NP_001305998.1
          NM_001319070.1 Intron NP_001305999.1
          NM_004763.4 Intron NP_004754.1
          NM_022334.4 Intron NP_071729.1
          XM_005246183.4 Intron XP_005246240.1
          XM_005246184.4 Intron XP_005246241.1
          XM_005246185.4 Intron XP_005246242.1
          XM_005246189.4 Intron XP_005246246.1
          XM_006711903.3 Intron XP_006711966.1
          XM_011510416.2 Intron XP_011508718.1
          XM_017005267.1 Intron XP_016860756.1
          XM_017005268.1 Intron XP_016860757.1
          XM_017005269.1 Intron XP_016860758.1
          XM_017005270.1 Intron XP_016860759.1

          Back To Top

          More Information


          Set Membership:

          HapMap

          Gene Ontology Categories:

          Function(s) Process(es)

          blood vessel endothelial cell proliferation involved in sprouting angiogenesis
          transcription, DNA-templated
          negative regulation of protein kinase activity
          negative regulation of cell adhesion involved in substrate-bound cell migration
          cell-matrix adhesion
          Notch signaling pathway
          integrin-mediated signaling pathway
          positive regulation of cell proliferation
          negative regulation of cell proliferation
          positive regulation of endothelial cell migration
          negative regulation of fibroblast migration
          protein transport
          cell migration
          cell differentiation
          biomineral tissue development
          negative regulation of protein binding
          activation of protein kinase B activity
          integrin activation
          regulation of cell adhesion mediated by integrin
          tube formation
          intracellular signal transduction
          cellular response to vascular endothelial growth factor stimulus
          regulation of GTPase activity
          receptor clustering
          cellular response to fibroblast growth factor stimulus
          positive regulation of Notch signaling pathway
          positive regulation of transcription from RNA polymerase II promoter
          regulation of blood vessel size
          myoblast migration
          positive regulation of stress fiber assembly
          positive regulation of cell division
          positive regulation of focal adhesion assembly
          negative regulation of focal adhesion assembly
          positive regulation of protein kinase B signaling
          negative regulation of ERK1 and ERK2 cascade
          negative regulation of cell migration involved in sprouting angiogenesis
          positive regulation of protein targeting to membrane
          negative regulation of protein targeting to membrane
          negative regulation of substrate adhesion-dependent cell spreading
          regulation of integrin-mediated signaling pathway
          GDP-dissociation inhibitor activity
          integrin binding
          protein binding
          protein transporter activity
          protein kinase binding
          protein complex binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-pgj68:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline