Hamburger Menu Button
Thermo Fisher Scientific Logo
Anmeldung
Sie haben noch kein Konto? Registrieren Sie sich hier
  • Produkte
    • Antikörper
    • Oligos, Primer, Sonden und Gene
    • TaqMan Real-Time PCR Assays
    • Zellkulturmedien
    • Chemikalien
    • Säulen und Kartuschen für die Chromatographie
    • Laborgeräte
    • Kunststoffartikel und Zubehör für das Labor
    • Mikrotiterplatten
    • Umweltfreundlichere Produkte
    • Alle Produktkategorien anzeigen
  • Anwendungen
    • Bioprocessing
    • Zellkultur und Transfektion
    • Zell- und Gentherapie
    • Chromatographie
    • Molekulare Testung
    • Digitale Lösungen
    • Extraktion und Analyse von DNA und RNA
    • Spektroskopie, Element- und Isotopenanalyse
    • Alle Anwendungen und Verfahren anzeigen
  • Service
    • 360° CDMO- und CRO-Services
    • CDMO-Services
    • CRO-Services
    • Kundenspezifische Services
    • Finanzierung und Leasing
    • Geräteservice
    • Laborinformatik
    • OEM und kommerzielle Bereitstellung
    • Schulungsdienstleistungen
    • Unity Lab Services
    • Alle Services anzeigen
  • Hilfe und Support
    • Für ein Konto registrieren
    • Bestellinformationen
    • Gerätesupport
    • Center für technischen Support
    • Lerncenter
    • Alle Themen für Hilfe und Support anzeigen
  • Häufigste Themen
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Für wen wir arbeiten
    • Biotechnologie
    • Biopharma
    • CDMO
    • Labordiagnostik
    • Angewandte Wissenschaften und Industrie
  • Sonderaktionen
  • Kontaktieren Sie uns
  • Eilbestellung
  • Status und Nachverfolgung von Bestellungen
  • Dokumente und Zertifikate
Thermo Fisher Scientific Logo

Search

Suchen in Alle
Search button
          • Auftragsstatus
          • Eilbestellung
          • Aktionen
          • Anmeldung
            Anmeldung
            Sie haben noch kein Konto? Registrieren Sie sich hier
            • Konto
            • Bestellungen
            • Connect: Labor, Daten, Apps
            • Spezialanfertigungen und Projekte
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 479217_mir

          Specificity testing was performed using human anti-targets.

          Assay Name: hsa-miR-941
          Stem-loop Accession Number: MI0005763
          miRBase Version: v22.1
          Chromosome Location: Chr.20: 63919449 - 63919520 [+] on Build GRCh38
          Mature miRNA Sequence: CACCCGGCUGUGUGCACAUGUGC
          Species: Human
          Product Type: TaqMan™ Advanced miRNA Assay
          Assay ID 479217_mir
          Size S: 250 rxns
          Availability Inventoried
          Catalog # A25576
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000387, mir-941

          Mature miRNA Sequence:

          CACCCGGCUGUGUGCACAUGUGC

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-941 MIMAT0004984

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-941-1
          Stem-loop Accession # MI0005763
          Stem-loop Sequence
          UGUGGACAUGUGCCCAGGGCCCGGGACAGCGCCACGGAAGAGGACGCACCCGGCUGUGUGCACAUGUGCCCA
          Chromosome Location Chr. 20 - 63919449 - 63919520 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0004984
          miRBase ID: hsa-miR-941
          Mature miRNA Sequence: CACCCGGCUGUGUGCACAUGUGC
          Chromosome Location: Chr. 20 - 63919756 - 63919827 [+] on Build GRCh38

          Stem-loop ID hsa-mir-941-2
          Stem-loop Accession # MI0005764
          Stem-loop Sequence
          UGUGCACAUGUGCCCAGGGCCCGGGACAGCGCCACGGAAGAGGACGCACCCGGCUGUGUGCACAUGUGCCCA
          Chromosome Location Chr. 20 - 63919505 - 63919576 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0004984
          miRBase ID: hsa-miR-941
          Mature miRNA Sequence: CACCCGGCUGUGUGCACAUGUGC
          Chromosome Location: Chr. 20 - 63919756 - 63919827 [+] on Build GRCh38

          Stem-loop ID hsa-mir-941-3
          Stem-loop Accession # MI0005765
          Stem-loop Sequence
          UGUGCACAUGUGCCCAGGGCCCGGGACAGCGCCACGGAAGAGGACGCACCCGGCUGUGUGCACAUGUGCCCA
          Chromosome Location Chr. 20 - 63919561 - 63919632 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0004984
          miRBase ID: hsa-miR-941
          Mature miRNA Sequence: CACCCGGCUGUGUGCACAUGUGC
          Chromosome Location: Chr. 20 - 63919756 - 63919827 [+] on Build GRCh38

          Stem-loop ID hsa-mir-941-4
          Stem-loop Accession # MI0005766
          Stem-loop Sequence
          UGUGCACAUGUGCCCAGGGCCCGGGACAGCGCCACGGAAGAGGACGCACCCGGCUGUGUGCACAUGUGCCCA
          Chromosome Location Chr. 20 - 63919756 - 63919827 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0004984
          miRBase ID: hsa-miR-941
          Mature miRNA Sequence: CACCCGGCUGUGUGCACAUGUGC
          Chromosome Location: Chr. 20 - 63919756 - 63919827 [+] on Build GRCh38

          Stem-loop ID hsa-mir-941-5
          Stem-loop Accession # MI0031520
          Stem-loop Sequence
          UGUGCACAUGUGCCCAGGGCCCGGGACAGCGCCACGGAAGAGGACGCACCCGGCUGUGUGCACAUGUGCCCA
          Chromosome Location Chr. 20 - 63919868 - 63919939 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0004984
          miRBase ID: hsa-miR-941
          Mature miRNA Sequence: CACCCGGCUGUGUGCACAUGUGC
          Chromosome Location: Chr. 20 - 63919756 - 63919827 [+] on Build GRCh38


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03305295_pri
          TaqMan™ Pri-miRNA Assay : Hs03305293_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM12273
          Ambion® Pre-miR™ miRNA Precursor : PM12273
          TaqMan™ MicroRNA Assay : 002183
          mirVana® miRNA inhibitor : MH12273
          mirVana® miRNA mimic : MC12273
          FGMIR : QS TaqmanTM OpenArray Human Advanced miRNA Panel
          FGMIR : TaqManTM Advanced miRNA Human B 96-well Plate 3
          MIRNA : TaqMan® Advanced miRNA Human A and B 96-well Plates, Standard
          MIRNA : TaqMan® Advanced miRNA Human B 96-well Plates, Standard
          FGMIR : TaqManTM Advanced miRNA Human B 96-well Plate 3
          FGMIR : TaqManTM Advanced miRNA Human B Card
          MIRNA : TaqMan® OpenArray® Human Advanced MicroRNA Panel
          MIRNA : TaqMan® Advanced miRNA Human A and B Cards
          MIRNA : TaqMan® Advanced miRNA Human B Card

          Back To Top

          Related Products

          • TaqMan® Advanced miRNA cDNA Synthesis Kit
          • TaqMan® Fast Advanced Master Mix
          Bestellung Plus Icon Minus Icon
          • Auftragsstatus
          • Hilfe zu Bestellungen
          • Eilbestellung
          • Versorgungszentrum
          • Elektronische Beschaffung
          • Preis- und Frachtregeln
          Support Plus Icon Minus Icon
          • Hilfe und Support
          • Kontaktieren Sie uns
          • Center für technischen Support
          • Dokumente und Zertifikate
          • Meldung von Problemen auf der Webseite
          Ressourcen Plus Icon Minus Icon
          • Lerncenter
          • Sonderaktionen
          • Veranstaltungen und Webinare
          • Soziale Netzwerke
          Über Thermo Fisher Plus Icon Minus Icon
          • Über uns Über uns
          • Karriere Karriere
          • Investoren Investoren
          • News News
          • Soziale Verantwortung Soziale Verantwortung
          • Marken
          • Lieferkettensorgfaltspflichtengesetz
          • Richtlinien und Hinweise
          Unser Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Impressum
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-zsnhf:80/100.66.75.14:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline