Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 001634
          Assay Name: mmu-miR-700
          miRBase Accession Number: MI0004684
          miRBase Version: v22.1
          Chromosome Location: Chr.4: 135416555 - 135416633 [-] on Build GRCm38
          Mature miRNA Sequence: CACGCGGGAACCGAGUCCACC
          Species: Mouse
          Product Type: TaqMan™ MicroRNA Assay
          Assay ID 001634
          Size
          Availability Made To Order
          Catalog # 4440886
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Mature miRNA Sequence:

          CACGCGGGAACCGAGUCCACC

          Mature miRNA Details:



          Species miRBase ID miRBase Accession Number
          Mouse mmu-miR-700-3p MIMAT0003490

          Stem-loop Details



          Mouse

          Stem-loop ID mmu-mir-700
          Stem-loop Accession # MI0004684
          Stem-loop Sequence
          UUCACUGGGAGUAAGGCUCCUUCCUGUGCUUGCAGGGGAGAAAUACGAACUGCACGCGGGAACCGAGUCCACCCCCAGU
          Chromosome Location Chr. 4 - 135416555 - 135416633 [-] on Build GRCm38
          Mature MicroRNA miRBase Accession #: MIMAT0003490
          miRBase ID: mmu-miR-700-3p
          Mature miRNA Sequence: CACGCGGGAACCGAGUCCACC
          Chromosome Location: Chr. 4 - 135416555 - 135416633 [-] on Build GRCm38


          Back To Top

          More Information


          Associated Megaplex™ RT Primer Pool:

          Megaplex™ RT Primers, Rodent Pool B v3.0


          Associated TaqMan® Array MicroRNA Card:

          TaqMan® Rodent MicroRNA B Cards v3.0


          TaqMan® OpenArray® MicroRNA Panel:

          TaqMan® OpenArray® Rodent MicroRNA Panel




          Related Products

          TaqMan™ Pri-miRNA Assay : Mm03308200_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM11372
          Ambion® Pre-miR™ miRNA Precursor : PM11372
          mirVana® miRNA inhibitor : MH11372
          mirVana® miRNA mimic : MC11372
          TaqMan™ Advanced miRNA Assay : mmu482232_mir
          miRNA Card : TaqMan® Rodent MicroRNA B Cards v2.0
          MIRNA : TaqMan® Array Rodent MicroRNA B Cards v3.0
          FGMIR : QS TaqMan OpenArray Hu miRNA Plate
          MIRNA : TaqMan® Array Rodent MicroRNA A+B Cards Set v3.0
          miRNA Card : TaqMan® Rodent MicroRNA B Cards v3.0
          FGMIR : TaqManTM Array Rodent MicroRNA B Card v3
          miRNA Pool : Megaplex™ RT Primers, Rodent Pool B v3.0
          MIRNA : TaqMan® OpenArray Human MicroRNA Panel


          miRBase Alias:

          Mouse: mmu-miR-700 (v17)

          Back To Top

          Related Products

          • TaqMan® Universal Master Mix II, with UNG
          • TaqMan® Universal Master Mix II, no UNG
          • TaqMan® MicroRNA Reverse Transcription Kit
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          • Price & Freight Policy
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • German Supply Chain Due Diligence Act
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Legal Notice
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Germany flag icon
          Germany

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-x75fr:80/100.66.77.4:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline