Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign In
Don't have an account ? Create Account
  • Applications
    • Real-Time PCR
    • Oligos, Primers, Probes and Genes
    • Cloning
    • Protein Biology
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Cell Analysis
    • Mass Spectrometry
    • Chromatography
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Online Order
    • Custom Primers & TaqMan Probes
    • miRNA Mimics & Inhibitors
    • Stealth RNAi / siRNA
    • Silencer Select siRNAs
    • Custom DNA Oligos
    • GeneArt Services
    • GeneArt Strings DNA Fragments
    • TrueGuide CRISPR gRNA
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all online orderable products
  • Services
    • Custom Services
    • Instrument Qualification Services
    • Technical Services
    • Pipette Services
    • Sample Request
    • Instrument Maintenance Services
    • Repairs and Relocation Services
    • OEM and Licensing Services
    • Events, Seminars, Training
    • Unity Lab Services
    • See all services
  • Support
    • Catalogs
    • Application Notes
    • Safety Data Sheets
    • Legal and Regulatory
    • Certificates of Analysis Search
    • Nunc/Nalgene Product Certificates
    • e-learning
    • FAQs
    • Learning Centers
    • Technical Support Centers
    • See all help and support topics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign In
            Sign In
            Don't have an account ? Create Account
            • Connect Your Lab
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › AM20089
          Assay Name: rno-miR-487b-5p
          miRBase Accession Number: MI0003547
          miRBase Version: v22.1
          Chromosome Location: Chr.6: 133877124 - 133877205 [+] on Build Rnor_6.0
          Mature miRNA Sequence: AGUGGUUAUCCCUGUCCUCUUCG
          Species: Rat
          Product Type: Ambion® Anti-miR™ miRNA Inhibitor
          Assay ID AM20089
          Size
          Availability Made To Order
          Catalog # AM17000
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000018, mir-154

          Mature miRNA Sequence:

          AGUGGUUAUCCCUGUCCUCUUCG

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Rat rno-miR-487b-5p MIMAT0017221

          Stem-loop Details



          Rat

          Stem-loop ID rno-mir-487b
          Stem-loop Accession # MI0003547
          Stem-loop Sequence
          UGGUACUUGGAGAGUGGUUAUCCCUGUCCUCUUCGCUUCACUUAUGCCGAAUCGUACAGGGUCAUCCACUUUUUCAGUAUCA
          Chromosome Location Chr. 6 - 133877124 - 133877205 [+] on Build Rnor_6.0
          Mature MicroRNA miRBase Accession #: MIMAT0017221
          miRBase ID: rno-miR-487b-5p
          Mature miRNA Sequence: AGUGGUUAUCCCUGUCCUCUUCG
          Chromosome Location: Chr. 6 - 133877124 - 133877205 [+] on Build Rnor_6.0


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Rn03464898_pri
          Ambion® Pre-miR™ miRNA Precursor : PM20089
          TaqMan™ MicroRNA Assay : 461826_mat
          mirVana® miRNA inhibitor : MH20089
          mirVana® miRNA mimic : MC20089
          TaqMan™ Advanced miRNA Assay : rno481185_mir


          miRBase Alias:

          Rat: rno-miR-487b* (v18)

          Back To Top

          Related Products

          Ordering Plus Icon Minus Icon
          • Online Orderable Products
          • Privacy Policy for Online Ordering
          • Act on Specified Commercial Transactions
          • About Returns
          • About Displayed Prices
          • About Shipping Fees
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Study information disclosure
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Seminars
          • Blog
          About Thermo Fisher Plus Icon Minus Icon
          • Corporate Information
          • Social Responsibility (CSR)
          • Enhancing Customer Experience
          • Careers Careers
          • News
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Japan flag icon
          Japan

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline