Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign In
Don't have an account ? Create Account
  • Applications
    • Real-Time PCR
    • Oligos, Primers, Probes and Genes
    • Cloning
    • Protein Biology
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Cell Analysis
    • Mass Spectrometry
    • Chromatography
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Online Order
    • Custom Primers & TaqMan Probes
    • miRNA Mimics & Inhibitors
    • Stealth RNAi / siRNA
    • Silencer Select siRNAs
    • Custom DNA Oligos
    • GeneArt Services
    • GeneArt Strings DNA Fragments
    • TrueGuide CRISPR gRNA
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all online orderable products
  • Services
    • Custom Services
    • Instrument Qualification Services
    • Technical Services
    • Pipette Services
    • Sample Request
    • Instrument Maintenance Services
    • Repairs and Relocation Services
    • OEM and Licensing Services
    • Events, Seminars, Training
    • Unity Lab Services
    • See all services
  • Support
    • Catalogs
    • Application Notes
    • Safety Data Sheets
    • Legal and Regulatory
    • Certificates of Analysis Search
    • Nunc/Nalgene Product Certificates
    • e-learning
    • FAQs
    • Learning Centers
    • Technical Support Centers
    • See all help and support topics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign In
            Sign In
            Don't have an account ? Create Account
            • Connect Your Lab
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_102357373_10
          See other ADCYAP1 GT Assays ›
          SNP ID:
          rs79120479
          Gene
          ADCYAP1
          Gene Name
          adenylate cyclase activating polypeptide 1
          Set Membership:
          -
          Chromosome Location:
          Chr.18: 911665 - 911665 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          TTTAATTCCGCAGTCTCCTCAGGCA[A/T]TGTGACACGGGATGCAGTTTGCAGC

          Assay ID C_102357373_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 102980

          Literature Links:

          ADCYAP1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.01)
          (0.99)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.00)
          (1.00)
          AMR
          T (0.00)
          (1.00)
          ADCYAP1 - adenylate cyclase activating polypeptide 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001099733.1 3079 UTR 3 NP_001093203.1
          NM_001117.4 3079 UTR 3 NP_001108.2
          XM_005258081.3 3079 UTR 3 XP_005258138.1

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          neuropeptide

          Gene Ontology Categories:

          Function(s) Process(es)

          ovarian follicle development
          behavioral fear response
          histamine secretion
          negative regulation of acute inflammatory response to antigenic stimulus
          negative regulation of acute inflammatory response to non-antigenic stimulus
          activation of adenylate cyclase activity
          positive regulation of cytosolic calcium ion concentration
          neuropeptide signaling pathway
          cell-cell signaling
          female pregnancy
          regulation of G-protein coupled receptor protein signaling pathway
          positive regulation of cell proliferation
          positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway
          negative regulation of muscle cell apoptotic process
          positive regulation of neuron projection development
          sensory perception of pain
          cAMP-mediated signaling
          pituitary gland development
          neuron projection development
          positive regulation of interleukin-6 production
          regulation of protein localization
          negative regulation of GTPase activity
          response to starvation
          negative regulation of potassium ion transport
          positive regulation of GTPase activity
          response to ethanol
          negative regulation of cell cycle
          positive regulation of protein kinase activity
          positive regulation of vasodilation
          positive regulation of transcription from RNA polymerase II promoter
          ATP metabolic process
          positive regulation of synaptic transmission, glutamatergic
          regulation of postsynaptic membrane potential
          positive regulation of growth hormone secretion
          negative regulation of glial cell proliferation
          positive regulation of ERK1 and ERK2 cascade
          regulation of oligodendrocyte progenitor proliferation
          cellular response to glucocorticoid stimulus
          positive regulation of chemokine (C-C motif) ligand 5 production
          positive regulation of somatostatin secretion
          receptor signaling protein activity
          receptor binding
          neuropeptide hormone activity
          protein binding
          pituitary adenylate cyclase activating polypeptide activity
          pituitary adenylate cyclase-activating polypeptide receptor binding
          peptide hormone receptor binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Online Orderable Products
          • Privacy Policy for Online Ordering
          • Act on Specified Commercial Transactions
          • About Returns
          • About Displayed Prices
          • About Shipping Fees
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Study information disclosure
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Seminars
          • Blog
          About Thermo Fisher Plus Icon Minus Icon
          • Corporate Information
          • Social Responsibility (CSR)
          • Enhancing Customer Experience
          • Careers Careers
          • News
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Japan flag icon
          Japan

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline