Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign In
Don't have an account ? Create Account
  • Applications
    • Real-Time PCR
    • Oligos, Primers, Probes and Genes
    • Cloning
    • Protein Biology
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Cell Analysis
    • Mass Spectrometry
    • Chromatography
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Online Order
    • Custom Primers & TaqMan Probes
    • miRNA Mimics & Inhibitors
    • Stealth RNAi / siRNA
    • Silencer Select siRNAs
    • Custom DNA Oligos
    • GeneArt Services
    • GeneArt Strings DNA Fragments
    • TrueGuide CRISPR gRNA
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all online orderable products
  • Services
    • Custom Services
    • Instrument Qualification Services
    • Technical Services
    • Pipette Services
    • Sample Request
    • Instrument Maintenance Services
    • Repairs and Relocation Services
    • OEM and Licensing Services
    • Events, Seminars, Training
    • Unity Lab Services
    • See all services
  • Support
    • Catalogs
    • Application Notes
    • Safety Data Sheets
    • Legal and Regulatory
    • Certificates of Analysis Search
    • Nunc/Nalgene Product Certificates
    • e-learning
    • FAQs
    • Learning Centers
    • Technical Support Centers
    • See all help and support topics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign In
            Sign In
            Don't have an account ? Create Account
            • Connect Your Lab
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_104049722_10
          See other ENPP1 GT Assays ›
          SNP ID:
          rs80231701
          Gene
          ENPP1
          Gene Name
          ectonucleotide pyrophosphatase/phosphodiesterase 1
          Set Membership:
          -
          Chromosome Location:
          Chr.6: 131879896 - 131879896 on Build GRCh38
          Polymorphism:
          A/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          TGACCCAAGAGAAGATTATTAAGCA[A/T]GAAACTTTACCCTATGGAAGACCTA

          Assay ID C_104049722_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 173335

          Literature Links:

          ENPP1 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          A (0.00)
          (1.00)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          A (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          A (0.00)
          (1.00)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          A (0.00)
          (1.00)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          A (0.00)
          (1.00)
          AMR
          A (0.00)
          (1.00)
          ENPP1 - ectonucleotide pyrophosphatase/phosphodiesterase 1
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_006208.2 911 Missense Mutation CAA,CAT Q,H 654 NP_006199.2
          XM_011535896.1 911 Missense Mutation CAA,CAT Q,H 284 XP_011534198.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          generation of precursor metabolites and energy
          riboflavin metabolic process
          phosphate-containing compound metabolic process
          receptor-mediated endocytosis
          immune response
          nucleoside triphosphate catabolic process
          negative regulation of cell growth
          regulation of bone mineralization
          inorganic diphosphate transport
          cellular phosphate ion homeostasis
          sequestering of triglyceride
          biomineral tissue development
          negative regulation of protein autophosphorylation
          cellular response to insulin stimulus
          negative regulation of fat cell differentiation
          negative regulation of glycogen biosynthetic process
          negative regulation of glucose import
          negative regulation of insulin receptor signaling pathway
          3'-phosphoadenosine 5'-phosphosulfate metabolic process
          nucleic acid phosphodiester bond hydrolysis
          nucleic acid binding
          phosphodiesterase I activity
          nucleotide diphosphatase activity
          scavenger receptor activity
          insulin receptor binding
          calcium ion binding
          protein binding
          ATP binding
          zinc ion binding
          polysaccharide binding
          NADH pyrophosphatase activity
          protein homodimerization activity
          nucleoside-triphosphate diphosphatase activity
          3'-phosphoadenosine 5'-phosphosulfate binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Online Orderable Products
          • Privacy Policy for Online Ordering
          • Act on Specified Commercial Transactions
          • About Returns
          • About Displayed Prices
          • About Shipping Fees
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Study information disclosure
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Seminars
          • Blog
          About Thermo Fisher Plus Icon Minus Icon
          • Corporate Information
          • Social Responsibility (CSR)
          • Enhancing Customer Experience
          • Careers Careers
          • News
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Japan flag icon
          Japan

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline