Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign In
Don't have an account ? Create Account
  • Applications
    • Real-Time PCR
    • Oligos, Primers, Probes and Genes
    • Cloning
    • Protein Biology
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Cell Analysis
    • Mass Spectrometry
    • Chromatography
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Online Order
    • Custom Primers & TaqMan Probes
    • miRNA Mimics & Inhibitors
    • Stealth RNAi / siRNA
    • Silencer Select siRNAs
    • Custom DNA Oligos
    • GeneArt Services
    • GeneArt Strings DNA Fragments
    • TrueGuide CRISPR gRNA
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all online orderable products
  • Services
    • Custom Services
    • Instrument Qualification Services
    • Technical Services
    • Pipette Services
    • Sample Request
    • Instrument Maintenance Services
    • Repairs and Relocation Services
    • OEM and Licensing Services
    • Events, Seminars, Training
    • Unity Lab Services
    • See all services
  • Support
    • Catalogs
    • Application Notes
    • Safety Data Sheets
    • Legal and Regulatory
    • Certificates of Analysis Search
    • Nunc/Nalgene Product Certificates
    • e-learning
    • FAQs
    • Learning Centers
    • Technical Support Centers
    • See all help and support topics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign In
            Sign In
            Don't have an account ? Create Account
            • Connect Your Lab
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_104067665_10
          See other CITED2 GT Assays ›
          SNP ID:
          rs75804913
          Gene
          CITED2
          Gene Name
          Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2
          Set Membership:
          -
          Chromosome Location:
          Chr.6: 139372296 - 139372296 on Build GRCh38
          Polymorphism:
          G/T, Transversion substitution
          Context Sequence [VIC/FAM]:

          TTATTGACATTGGCAAATTAAAATA[G/T]AATAAATTAACAAGTATTTTTTCAA

          Assay ID C_104067665_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 602937

          Literature Links:

          CITED2 PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global
          T (0.02)
          (0.98)
          Caucasian - Not Available CEPH (CEU) - Not Available
          EAS
          T (0.00)
          (1.00)
          African American - Not Available YRI (Yoruba) - Not Available
          SAS
          T (0.01)
          (0.99)
          Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR
          T (0.03)
          (0.97)
          Japanese - Not Available JPT (Japanese) - Not Available
          EUR
          T (0.01)
          (0.99)
          AMR
          T (0.02)
          (0.98)
          CITED2 - Cbp/p300 interacting transactivator with Glu/Asp rich carboxy-terminal domain 2
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001168388.2 1895 UTR 3 NP_001161860.1
          NM_001168389.2 1895 UTR 3 NP_001161861.2
          NM_006079.4 1895 UTR 3 NP_006070.2

          Back To Top

          More Information


          Panther Classification:

          Molecular Function -

          transcription cofactor

          Gene Ontology Categories:

          Function(s) Process(es)

          negative regulation of transcription from RNA polymerase II promoter
          response to hypoxia
          liver development
          outflow tract morphogenesis
          regulation of organ formation
          transcription, DNA-templated
          determination of left/right symmetry
          heart development
          sex determination
          cell proliferation
          positive regulation of gene expression
          negative regulation of gene expression
          positive regulation of cell-cell adhesion
          cell differentiation
          negative regulation of cell migration
          positive regulation of transforming growth factor beta receptor signaling pathway
          response to fluid shear stress
          positive regulation of peroxisome proliferator activated receptor signaling pathway
          adrenal cortex formation
          negative regulation of apoptotic process
          response to estrogen
          positive regulation of cell cycle
          negative regulation of transcription, DNA-templated
          positive regulation of transcription, DNA-templated
          positive regulation of transcription from RNA polymerase II promoter
          spleen development
          ventricular septum morphogenesis
          embryonic heart tube left/right pattern formation
          left/right pattern formation
          negative regulation of transcription from RNA polymerase II promoter in response to hypoxia
          left/right axis specification
          nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry
          positive regulation of male gonad development
          RNA polymerase II transcription coactivator activity
          RNA polymerase II transcription corepressor activity
          chromatin binding
          transcription factor activity, sequence-specific DNA binding
          transcription coactivator activity
          transcription corepressor activity
          protein binding
          histone acetyltransferase binding
          LBD domain binding

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Online Orderable Products
          • Privacy Policy for Online Ordering
          • Act on Specified Commercial Transactions
          • About Returns
          • About Displayed Prices
          • About Shipping Fees
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Study information disclosure
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Seminars
          • Blog
          About Thermo Fisher Plus Icon Minus Icon
          • Corporate Information
          • Social Responsibility (CSR)
          • Enhancing Customer Experience
          • Careers Careers
          • News
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Japan flag icon
          Japan

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-5cvsx:80/100.66.79.163:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline