Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
GGTGGGCCGAGGGTGGACGGGGCGA[C/G]GGCGCGGCGCGCCTGGGGCCCGGTG
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 608460 | ||||||||||||||||||||
Literature Links: |
VPS9D1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap |
---|---|---|
Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
EUR - Not Available | ||
AMR - Not Available |
VPS9D1 - VPS9 domain containing 1 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_004913.2 | 234 | Intron | NP_004904.2 | |||
XM_005256329.4 | 234 | Intron | XP_005256386.1 | |||
XM_005256330.4 | 234 | Intron | XP_005256387.1 | |||
XM_005256331.2 | 234 | Intron | XP_005256388.1 | |||
XM_006721350.2 | 234 | Intron | XP_006721413.1 | |||
XM_011523476.2 | 234 | Intron | XP_011521778.1 | |||
XM_011523477.2 | 234 | Intron | XP_011521779.1 | |||
XM_011523478.2 | 234 | Intron | XP_011521780.1 | |||
XM_011523479.2 | 234 | Intron | XP_011521781.1 | |||
XM_011523480.2 | 234 | Intron | XP_011521782.1 |
VPS9D1-AS1 - VPS9D1 antisense RNA 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
ZNF276 - zinc finger protein 276 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001113525.1 | 234 | Missense Mutation | ACG,AGG | T,R 46 | NP_001106997.1 | |
NM_152287.3 | 234 | Intron | NP_689500.2 | |||
XM_005256324.3 | 234 | Missense Mutation | ACG,AGG | T,R 46 | XP_005256381.1 | |
XM_005256328.3 | 234 | Intron | XP_005256385.1 | |||
XM_017023889.1 | 234 | Missense Mutation | ACG,AGG | T,R 46 | XP_016879378.1 | |
XM_017023890.1 | 234 | Intron | XP_016879379.1 |