Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CACCCCCAAGTACTTCTGTTGCTGA[C/T]CATTCTCCTCTTGGCTCACCAAGTC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 616467 MIM: 606343 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
DPCD PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
DPCD - deleted in primary ciliary dyskinesia homolog (mouse) | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
POLL - polymerase (DNA) lambda | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001174084.1 | 1898 | Missense Mutation | GAT,GGT | D,G 468 | NP_001167555.1 | |
NM_001174085.1 | 1898 | Missense Mutation | GAT,GGT | D,G 376 | NP_001167556.1 | |
NM_001308382.1 | 1898 | Missense Mutation | GAT,GGT | D,G 193 | NP_001295311.1 | |
NM_013274.3 | 1898 | Missense Mutation | GAT,GGT | D,G 468 | NP_037406.1 | |
XM_006717775.1 | 1898 | Missense Mutation | GAT,GGT | D,G 207 | XP_006717838.1 | |
XM_006717776.1 | 1898 | Missense Mutation | GAT,GGT | D,G 207 | XP_006717839.1 | |
XM_006717777.1 | 1898 | Missense Mutation | GAT,GGT | D,G 193 | XP_006717840.1 | |
XM_011539650.1 | 1898 | Missense Mutation | GAT,GGT | D,G 475 | XP_011537952.1 | |
XM_011539651.1 | 1898 | Missense Mutation | GAT,GGT | D,G 468 | XP_011537953.1 | |
XM_011539652.1 | 1898 | Missense Mutation | GAT,GGT | D,G 475 | XP_011537954.1 | |
XM_011539653.1 | 1898 | Missense Mutation | GAT,GGT | D,G 475 | XP_011537955.1 | |
XM_011539654.1 | 1898 | Missense Mutation | GAT,GGT | D,G 383 | XP_011537956.1 | |
XM_011539655.1 | 1898 | Missense Mutation | GAT,GGT | D,G 376 | XP_011537957.1 | |
XM_011539656.1 | 1898 | Missense Mutation | GAT,GGT | D,G 369 | XP_011537958.1 | |
XM_011539657.1 | 1898 | Missense Mutation | GAT,GGT | D,G 387 | XP_011537959.1 | |
XM_011539659.1 | 1898 | Missense Mutation | GAT,GGT | D,G 306 | XP_011537961.1 | |
XM_011539660.1 | 1898 | Missense Mutation | GAT,GGT | D,G 306 | XP_011537962.1 | |
XM_011539662.1 | 1898 | Missense Mutation | GAT,GGT | D,G 214 | XP_011537964.1 | |
XM_011539663.1 | 1898 | Missense Mutation | GAT,GGT | D,G 214 | XP_011537965.1 | |
XM_011539664.1 | 1898 | Missense Mutation | GAT,GGT | D,G 200 | XP_011537966.1 | |
XM_011539665.2 | 1898 | Missense Mutation | GAT,GGT | D,G 200 | XP_011537967.1 | |
XM_011539666.1 | 1898 | Missense Mutation | GAT,GGT | D,G 200 | XP_011537968.1 | |
XM_011539667.1 | 1898 | Missense Mutation | GAT,GGT | D,G 160 | XP_011537969.1 | |
XM_017016084.1 | 1898 | Missense Mutation | GAT,GGT | D,G 374 | XP_016871573.1 | |
XM_017016085.1 | 1898 | Missense Mutation | GAT,GGT | D,G 367 | XP_016871574.1 | |
XM_017016086.1 | 1898 | Missense Mutation | GAT,GGT | D,G 362 | XP_016871575.1 | |
XM_017016087.1 | 1898 | Missense Mutation | GAT,GGT | D,G 282 | XP_016871576.1 | |
XM_017016088.1 | 1898 | UTR 3 | XP_016871577.1 | |||
XM_017016089.1 | 1898 | Missense Mutation | GAT,GGT | D,G 306 | XP_016871578.1 | |
XM_017016090.1 | 1898 | UTR 3 | XP_016871579.1 | |||
XM_017016091.1 | 1898 | Missense Mutation | GAT,GGT | D,G 299 | XP_016871580.1 | |
XM_017016092.1 | 1898 | UTR 3 | XP_016871581.1 | |||
XM_017016093.1 | 1898 | Missense Mutation | GAT,GGT | D,G 200 | XP_016871582.1 |