Search
LOADING 
- SNP ID:
- rs761261547
- Gene
-
KANK3NDUFA7RPS28 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.19: 8328017 - 8328017 on Build GRCh38
- Polymorphism:
- G/A, Transition substitution
- Context Sequence [VIC/FAM]:
ACCCTGGCTAGGCACAGTGGCTTAC[G/A]CCTATAATTCCAGAACACTGGAGGC
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 614611
MIM: 602139
MIM: 603685
|
||||||||||||||||||||
Literature Links: |
KANK3 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| KANK3 - KN motif and ankyrin repeat domains 3 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_198471.2 | Intron | NP_940873.2 | ||||
| XM_006722718.3 | Intron | XP_006722781.1 | ||||
| XM_011527884.2 | Intron | XP_011526186.1 | ||||
| XM_017026563.1 | Intron | XP_016882052.1 | ||||
| NDUFA7 - NADH:ubiquinone oxidoreductase subunit A7 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| RPS28 - ribosomal protein S28 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
Back To Top