Search

  • Contact Us
  • Quick Order

System Message

OKCancel
LOADING ...
See other HPDL GT Assays ›
SNP ID:
rs759295912
Gene
HPDL MUTYH TOE1
Gene Name
Set Membership:
-
Chromosome Location:
Chr.1: 45332464 - 45332464 on Build GRCh38
Polymorphism:
C/T, Transition substitution
Context Sequence [VIC/FAM]:

CGGACACGGCACAGCACCCGTGCTA[C/T]GTTGCCATCCACCACACCGGTTGCC

Assay ID C_362932780_10
Size
Availability Made To Order
Catalog # 4351379
Price
Your Price
Online offer:
Check your price ›

Assay Details



Species:

 Human

dbSNP Submissions:

 2 submissions

Phenotype:

 MIM: 604933 MIM: 613931

Literature Links:

 HPDL PubMed Links

Allele Nomenclature:

Minor Allele Frequency:
1000Genome Applied Biosystems® HapMap
Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
EUR - Not Available
AMR - Not Available
HPDL - 4-hydroxyphenylpyruvate dioxygenase like
There are no transcripts associated with this gene.
MUTYH - mutY DNA glycosylase
Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
NM_001048171.1 683 Missense Mutation ATA,GTA I,V 225 NP_001041636.1
NM_001048172.1 683 Missense Mutation ATA,GTA I,V 212 NP_001041637.1
NM_001048173.1 683 Missense Mutation ATA,GTA I,V 211 NP_001041638.1
NM_001048174.1 683 Missense Mutation ATA,GTA I,V 211 NP_001041639.1
NM_001128425.1 683 Missense Mutation ATA,GTA I,V 239 NP_001121897.1
NM_001293190.1 683 Missense Mutation ATA,GTA I,V 226 NP_001280119.1
NM_001293191.1 683 Missense Mutation ATA,GTA I,V 222 NP_001280120.1
NM_001293192.1 683 Missense Mutation ATA,GTA I,V 119 NP_001280121.1
NM_001293195.1 683 Missense Mutation ATA,GTA I,V 211 NP_001280124.1
NM_001293196.1 683 Missense Mutation ATA,GTA I,V 119 NP_001280125.1
NM_012222.2 683 Missense Mutation ATA,GTA I,V 236 NP_036354.1
XM_011541497.2 683 Missense Mutation ATA,GTA I,V 231 XP_011539799.1
XM_011541498.1 683 Missense Mutation ATA,GTA I,V 225 XP_011539800.1
XM_011541499.1 683 Missense Mutation ATA,GTA I,V 225 XP_011539801.1
XM_011541500.2 683 Missense Mutation ATA,GTA I,V 225 XP_011539802.1
XM_011541501.2 683 Missense Mutation ATA,GTA I,V 225 XP_011539803.1
XM_011541502.2 683 Missense Mutation ATA,GTA I,V 225 XP_011539804.1
XM_011541503.2 683 Missense Mutation ATA,GTA I,V 225 XP_011539805.1
XM_011541504.2 683 Missense Mutation ATA,GTA I,V 222 XP_011539806.1
XM_011541505.2 683 Missense Mutation ATA,GTA I,V 85 XP_011539807.1
XM_011541506.1 683 Missense Mutation ATA,GTA I,V 85 XP_011539808.1
XM_011541507.2 683 Missense Mutation ATA,GTA I,V 73 XP_011539809.2
XM_017001331.1 683 Missense Mutation ATA,GTA I,V 225 XP_016856820.1
XM_017001332.1 683 Missense Mutation ATA,GTA I,V 225 XP_016856821.1
XM_017001333.1 683 Missense Mutation ATA,GTA I,V 225 XP_016856822.1
XM_017001334.1 683 Missense Mutation ATA,GTA I,V 212 XP_016856823.1
XM_017001335.1 683 Missense Mutation ATA,GTA I,V 119 XP_016856824.1
XM_017001336.1 683 Missense Mutation ATA,GTA I,V 96 XP_016856825.1
XM_017001337.1 683 Missense Mutation ATA,GTA I,V 96 XP_016856826.1
XM_017001338.1 683 Missense Mutation ATA,GTA I,V 96 XP_016856827.1
XM_017001339.1 683 Missense Mutation ATA,GTA I,V 96 XP_016856828.1
TOE1 - target of EGR1, member 1 (nuclear)
There are no transcripts associated with this gene.

Back To Top

Related Products