Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign In
Don't have an account ? Create Account
  • Applications
    • Real-Time PCR
    • Oligos, Primers, Probes and Genes
    • Cloning
    • Protein Biology
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Cell Analysis
    • Mass Spectrometry
    • Chromatography
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Online Order
    • Custom Primers & TaqMan Probes
    • miRNA Mimics & Inhibitors
    • Stealth RNAi / siRNA
    • Silencer Select siRNAs
    • Custom DNA Oligos
    • GeneArt Services
    • GeneArt Strings DNA Fragments
    • TrueGuide CRISPR gRNA
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all online orderable products
  • Services
    • Custom Services
    • Instrument Qualification Services
    • Technical Services
    • Pipette Services
    • Sample Request
    • Instrument Maintenance Services
    • Repairs and Relocation Services
    • OEM and Licensing Services
    • Events, Seminars, Training
    • Unity Lab Services
    • See all services
  • Support
    • Catalogs
    • Application Notes
    • Safety Data Sheets
    • Legal and Regulatory
    • Certificates of Analysis Search
    • Nunc/Nalgene Product Certificates
    • e-learning
    • FAQs
    • Learning Centers
    • Technical Support Centers
    • See all help and support topics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign In
            Sign In
            Don't have an account ? Create Account
            • Connect Your Lab
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › C_365375772_10
          See other TTN GT Assays ›
          SNP ID:
          rs371847228
          Gene
          TTN
          Gene Name
          titin
          Set Membership:
          -
          Chromosome Location:
          Chr.2: 178727728 - 178727728 on Build GRCh38
          Polymorphism:
          C/T, Transition substitution
          Context Sequence [VIC/FAM]:

          TTCCAAGCCAATGAAACATTTAGGA[C/T]CTGAGACAAGTTCCACATCATCCTT

          Assay ID C_365375772_10
          Size
          Availability Made To Order
          Catalog # 4351379
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details



          Species:

          Human

          dbSNP Submissions:

          NA

          Phenotype:

          MIM: 188840

          Literature Links:

          TTN PubMed Links

          Allele Nomenclature:

          Minor Allele Frequency:

          1000Genome Applied Biosystems® HapMap
          Global - Not Available Caucasian - Not Available CEPH (CEU) - Not Available
          EAS - Not Available African American - Not Available YRI (Yoruba) - Not Available
          SAS - Not Available Chinese - Not Available CHB (Han Chinese) - Not Available
          AFR - Not Available Japanese - Not Available JPT (Japanese) - Not Available
          EUR - Not Available
          AMR - Not Available
          TTN - titin
          Transcript Accession SNP Location SNP Type Observed Codons Observed Amino Acid Protein ID
          NM_001256850.1 19127 Missense Mutation GAT,GGT D,G 6300 NP_001243779.1
          NM_001267550.2 19127 Missense Mutation GAT,GGT D,G 6617 NP_001254479.2
          NM_003319.4 19127 Intron NP_003310.4
          NM_133378.4 19127 Missense Mutation GAT,GGT D,G 5373 NP_596869.4
          NM_133379.4 19127 Intron NP_596870.2
          NM_133432.3 19127 Intron NP_597676.3
          NM_133437.4 19127 Intron NP_597681.4
          XM_017004819.1 19127 Missense Mutation GAT,GGT D,G 6301 XP_016860308.1
          XM_017004820.1 19127 Missense Mutation GAT,GGT D,G 5374 XP_016860309.1
          XM_017004821.1 19127 Missense Mutation GAT,GGT D,G 5373 XP_016860310.1
          XM_017004822.1 19127 Missense Mutation GAT,GGT D,G 6301 XP_016860311.1
          XM_017004823.1 19127 Intron XP_016860312.1

          Back To Top

          More Information


          Gene Ontology Categories:

          Function(s) Process(es)

          platelet degranulation
          cardiac muscle hypertrophy
          muscle contraction
          striated muscle contraction
          mitotic chromosome condensation
          peptidyl-tyrosine phosphorylation
          muscle filament sliding
          skeletal muscle thin filament assembly
          skeletal muscle myosin thick filament assembly
          detection of muscle stretch
          sarcomere organization
          regulation of protein kinase activity
          cardiac muscle fiber development
          sarcomerogenesis
          regulation of catalytic activity
          response to calcium ion
          cardiac myofibril assembly
          cardiac muscle tissue morphogenesis
          cardiac muscle contraction
          protease binding
          protein serine/threonine kinase activity
          protein tyrosine kinase activity
          calcium ion binding
          protein binding
          calmodulin binding
          ATP binding
          structural constituent of muscle
          enzyme binding
          protein kinase binding
          telethonin binding
          identical protein binding
          actinin binding
          protein self-association
          actin filament binding
          muscle alpha-actinin binding
          structural molecule activity conferring elasticity

          Back To Top

          Related Products

          • TaqMan® Genotyping Master Mix
          Ordering Plus Icon Minus Icon
          • Online Orderable Products
          • Privacy Policy for Online Ordering
          • Act on Specified Commercial Transactions
          • About Returns
          • About Displayed Prices
          • About Shipping Fees
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Study information disclosure
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Seminars
          • Blog
          About Thermo Fisher Plus Icon Minus Icon
          • Corporate Information
          • Social Responsibility (CSR)
          • Enhancing Customer Experience
          • Careers Careers
          • News
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Japan flag icon
          Japan

          Your items have has been added!


          Host server : magellan-search-green-7d94cb4b65-6wvps:80/100.66.75.98:80.
          git-commit: c9e08c96761173abe34e68f880379696776a4827
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.44.1-2026.02.97.1.0