Search
LOADING 
- SNP ID:
- rs771901837
- Gene
-
TLR1TLR10 - Gene Name
- Set Membership:
- -
- Chromosome Location:
- Chr.4: 38778709 - 38778709 on Build GRCh38
- Polymorphism:
- G/A, Transition substitution
- Context Sequence [VIC/FAM]:
TGGGGGAGTTTTTCTGCTTCCATTT[G/A]TATGTATCTGTTACACATTGACCCT
Genomic Map
Back To TopAssay Details
Species: |
Human | ||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||
Phenotype: |
MIM: 601194
MIM: 606270
|
||||||||||||||||||||
Literature Links: |
TLR1 PubMed Links | ||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||
Minor Allele Frequency: |
| 1000Genome | Applied Biosystems® | HapMap |
|---|---|---|
| Global - Not Available | Caucasian - Not Available | CEPH (CEU) - Not Available |
| EAS - Not Available | African American - Not Available | YRI (Yoruba) - Not Available |
| SAS - Not Available | Chinese - Not Available | CHB (Han Chinese) - Not Available |
| AFR - Not Available | Japanese - Not Available | JPT (Japanese) - Not Available |
| EUR - Not Available | ||
| AMR - Not Available |
| TLR1 - toll like receptor 1 | ||||||
|---|---|---|---|---|---|---|
| There are no transcripts associated with this gene. | ||||||
| TLR10 - toll like receptor 10 | ||||||
|---|---|---|---|---|---|---|
| Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
| NM_001017388.2 | Intron | NP_001017388.1 | ||||
| NM_001195106.1 | Intron | NP_001182035.1 | ||||
| NM_001195107.1 | Intron | NP_001182036.1 | ||||
| NM_001195108.1 | Intron | NP_001182037.1 | ||||
| NM_030956.3 | Intron | NP_112218.2 | ||||
| XM_011513760.2 | Intron | XP_011512062.1 | ||||
| XM_011513761.2 | Intron | XP_011512063.1 | ||||
| XM_011513762.2 | Intron | XP_011512064.1 | ||||
Back To Top