Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
AGCGCCTCTTTCCCTTCGGTGTGGT[A/G]AGTAAGCGCAGTTGTCGTCTCTTGC
Species: |
Human | ||||||||||||||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 300081 MIM: 312173 | ||||||||||||||||||||||||||||||||||||||||||||||||||
Literature Links: |
DNASE1L1 PubMed Links | ||||||||||||||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | ||||||
---|---|---|---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU)
|
||||||
EAS
|
African American - Not Available | YRI (Yoruba)
|
||||||
SAS
|
Chinese - Not Available | JPT (Japanese)
|
||||||
AFR
|
Japanese - Not Available | CHB (Han Chinese)
|
||||||
EUR
|
||||||||
AMR
|
DNASE1L1 - deoxyribonuclease I-like 1 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
LOC107987332 - uncharacterized LOC107987332 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
XM_017030021.1 | 333 | Intron | XP_016885510.1 |
RPL10 - ribosomal protein L10 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001256577.2 | 333 | Intron | NP_001243506.2 | |||
NM_001256580.2 | 333 | Intron | NP_001243509.2 | |||
NM_001303624.1 | 333 | UTR 5 | NP_001290553.1 | |||
NM_001303625.1 | 333 | UTR 5 | NP_001290554.1 | |||
NM_001303626.1 | 333 | Intron | NP_001290555.1 | |||
NM_006013.4 | 333 | Intron | NP_006004.3 |
SNORA70 - small nucleolar RNA, H/ACA box 70 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
Set Membership: |
HapMap |