Search Thermo Fisher Scientific
- Contact Us
- Quick Order
-
Don't have an account ? Create Account
Search Thermo Fisher Scientific
CCCATAGGGCTGTGTCTGCCCAGTG[A/G]GGGCATCTTTTCCTAACTTGCTCAA
Species: |
Human | ||||||||||||||||||||||||||||||||||||||
dbSNP Submissions: |
NA
|
||||||||||||||||||||||||||||||||||||||
Phenotype: |
MIM: 300572 MIM: 300798 | ||||||||||||||||||||||||||||||||||||||
Literature Links: |
ADGRG2 PubMed Links | ||||||||||||||||||||||||||||||||||||||
Allele Nomenclature: |
|||||||||||||||||||||||||||||||||||||||
Minor Allele Frequency: |
1000Genome | Applied Biosystems® | HapMap | |||
---|---|---|---|---|---|
Global
|
Caucasian - Not Available | CEPH (CEU) - Not Available | |||
EAS
|
African American - Not Available | YRI (Yoruba) - Not Available | |||
SAS
|
Chinese - Not Available | CHB (Han Chinese) - Not Available | |||
AFR
|
Japanese - Not Available | JPT (Japanese) - Not Available | |||
EUR
|
|||||
AMR
|
ADGRG2 - adhesion G protein-coupled receptor G2 | ||||||
---|---|---|---|---|---|---|
Transcript Accession | SNP Location | SNP Type | Observed Codons | Observed Amino Acid | Protein ID | |
NM_001079858.2 | 3884 | UTR 3 | NP_001073327.1 | |||
NM_001079859.2 | 3884 | UTR 3 | NP_001073328.1 | |||
NM_001079860.2 | 3884 | UTR 3 | NP_001073329.1 | |||
NM_001184833.1 | 3884 | UTR 3 | NP_001171762.1 | |||
NM_001184834.1 | 3884 | UTR 3 | NP_001171763.1 | |||
NM_001184835.1 | 3884 | UTR 3 | NP_001171764.1 | |||
NM_001184836.1 | 3884 | UTR 3 | NP_001171765.1 | |||
NM_001184837.1 | 3884 | UTR 3 | NP_001171766.1 | |||
NM_005756.3 | 3884 | UTR 3 | NP_005747.2 | |||
XM_006724455.3 | 3884 | UTR 3 | XP_006724518.1 | |||
XM_011545434.1 | 3884 | UTR 3 | XP_011543736.1 | |||
XM_011545435.2 | 3884 | UTR 3 | XP_011543737.1 |
LOC101928415 - uncharacterized LOC101928415 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |
PHKA2 - phosphorylase kinase regulatory subunit alpha 2 | ||||||
---|---|---|---|---|---|---|
There are no transcripts associated with this gene. |