Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign In
Don't have an account ? Create Account
  • Applications
    • Real-Time PCR
    • Oligos, Primers, Probes and Genes
    • Cloning
    • Protein Biology
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Cell Analysis
    • Mass Spectrometry
    • Chromatography
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Online Order
    • Custom Primers & TaqMan Probes
    • miRNA Mimics & Inhibitors
    • Stealth RNAi / siRNA
    • Silencer Select siRNAs
    • Custom DNA Oligos
    • GeneArt Services
    • GeneArt Strings DNA Fragments
    • TrueGuide CRISPR gRNA
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • See all online orderable products
  • Services
    • Custom Services
    • Instrument Qualification Services
    • Technical Services
    • Pipette Services
    • Sample Request
    • Instrument Maintenance Services
    • Repairs and Relocation Services
    • OEM and Licensing Services
    • Events, Seminars, Training
    • Unity Lab Services
    • See all services
  • Support
    • Catalogs
    • Application Notes
    • Safety Data Sheets
    • Legal and Regulatory
    • Certificates of Analysis Search
    • Nunc/Nalgene Product Certificates
    • e-learning
    • FAQs
    • Learning Centers
    • Technical Support Centers
    • See all help and support topics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign In
            Sign In
            Don't have an account ? Create Account
            • Connect Your Lab
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › 480340_mir

          Specificity testing was performed using human anti-targets.

          Assay Name: hsa-miR-6785-3p
          Stem-loop Accession Number: MI0022630
          miRBase Version: v22.1
          Chromosome Location: Chr.17: 75498548 - 75498628 [+] on Build GRCh38
          Mature miRNA Sequence: ACAUCGCCCCACCUUCCCCAG
          Species: Human
          Product Type: TaqMan™ Advanced miRNA Assay
          Assay ID 480340_mir
          Size S: 250 rxns
          Availability Inventoried
          Catalog # A25576
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Mature miRNA Sequence:

          ACAUCGCCCCACCUUCCCCAG

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-6785-3p MIMAT0027471

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-6785
          Stem-loop Accession # MI0022630
          Stem-loop Sequence
          CUCCCUGGGAGGGCGUGGAUGAUGGUGGGAGAGGAGCCCCACUGUGGAAGUCUGACCCCCACAUCGCCCCACCUUCCCCAG
          Chromosome Location Chr. 17 - 75498548 - 75498628 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0027471
          miRBase ID: hsa-miR-6785-3p
          Mature miRNA Sequence: ACAUCGCCCCACCUUCCCCAG
          Chromosome Location: Chr. 17 - 75498548 - 75498628 [+] on Build GRCh38


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs04348169_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM27064
          Ambion® Pre-miR™ miRNA Precursor : PM27064
          mirVana® miRNA inhibitor : MH27064
          mirVana® miRNA mimic : MC27064

          Back To Top

          Related Products

          • TaqMan® Advanced miRNA cDNA Synthesis Kit
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Online Orderable Products
          • Privacy Policy for Online Ordering
          • Act on Specified Commercial Transactions
          • About Returns
          • About Displayed Prices
          • About Shipping Fees
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Study information disclosure
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Seminars
          • Blog
          About Thermo Fisher Plus Icon Minus Icon
          • Corporate Information
          • Social Responsibility (CSR)
          • Enhancing Customer Experience
          • Careers Careers
          • News
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Japan flag icon
          Japan

          Your items have has been added!


          Host server : magellan-search-blue-64dd947b88-tr4x4:80/100.66.75.98:80.
          git-commit: 0f46c0ba67a87c24f5ac662a3edafcaba07cd08c
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.45.0-Offline