Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture and Transfection
    • Chemicals
    • Chromatography
    • Electron Microscopes
    • Lab Plasticware and Supplies
    • Lab Centrifuges
    • Lab Solutions
    • Mass Spectrometers
    • Next Generation Sequencers
    • See all product categories
  • Applications
    • Brands
    • Industrial and Applied Sciences
    • Food and Beverage
    • Forensics
    • Lab Solutions
    • Life Sciences
    • Pharma and Biopharma
    • Biotechnology
    • Clinical and Diagnostics
    • Digital Solutions
    • See all applications
  • Services
    • Lab Instrument and Equipment Services
    • Custom Services
    • Training Services
    • Financial and Leasing Services
    • Enterprise Level Lab Informatics
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Cell Biology Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • Contact Us
    • Product Documentation
    • Knowledge Base and Product FAQs
    • Learning Centers
    • Supply Center
    • eProcurement Solutions
    • Lab Instrument and Equipment Support
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › MC12377
          Assay Name: mmu-miR-743a-3p
          miRBase Accession Number: MI0005207
          miRBase Version: v22.1
          Chromosome Location: Chr.X: 66776757 - 66776818 [-] on Build GRCm38
          Mature miRNA Sequence: GAAAGACACCAAGCUGAGUAGA
          Species: Mouse
          Product Type: mirVana® miRNA mimic
          Assay ID MC12377

          Purification
          Size
          Availability Made To Order
          Catalog # 4464066
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000386, mir-743

          Mature miRNA Sequence:

          GAAAGACACCAAGCUGAGUAGA

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Mouse mmu-miR-743a-3p MIMAT0004238

          Stem-loop Details



          Mouse

          Stem-loop ID mmu-mir-743a
          Stem-loop Accession # MI0005207
          Stem-loop Sequence
          CUGUAUUCAGAUUGGUGCCUGUCAUGUUUAUAAGAAUGAAAGACACCAAGCUGAGUAGAGUA
          Chromosome Location Chr. X - 66776757 - 66776818 [-] on Build GRCm38
          Mature MicroRNA miRBase Accession #: MIMAT0004238
          miRBase ID: mmu-miR-743a-3p
          Mature miRNA Sequence: GAAAGACACCAAGCUGAGUAGA
          Chromosome Location: Chr. X - 66776757 - 66776818 [-] on Build GRCm38


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Mm03308356_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM12377
          Ambion® Pre-miR™ miRNA Precursor : PM12377
          TaqMan™ MicroRNA Assay : 002469
          mirVana® miRNA inhibitor : MH12377


          miRBase Alias:

          Mouse: mmu-miR-743a (v17)

          Back To Top

          Related Products

          • Anti-GAPDH, Mouse Monoclonal 6C5
          • Anti-β-Actin, Mouse Monoclonal AC-15
          • TaqMan® Gene Expression Cells-to-CT™
          • Neon™ Transfection System 100 µL Kit
          • Lipofectamine™ RNAiMAX Transfection Reagent
          • Invivofectamine 2.0
          • Neon™ Transfection System
          Ordering Plus Icon Minus Icon
          • Quick Order
          • eProcurement
          • Supply Center
          • Order Status
          • Chemicals
          • India Mobile App
          • Government eMarketplace
          Support Plus Icon Minus Icon
          • Order Support
          • Training
          • Contact Us
          • Report a Site Issue
          • Instrument Management
          Resources Plus Icon Minus Icon
          • Product Selection Guides
          • Mobile & Desktop Apps
          • Webinars
          • Blog 
          • Social Media
          • New Products
          • Promotions
          • Shared Lists
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          India flag icon
          India

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-x75fr:80/100.66.77.4:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline