Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • New Products
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › Hs03303659_pri
          Assay Name:
          hsa-mir-345
          Stem-loop ID:
          hsa-mir-345
          Mapped to miRBase Version:
          v22.1
          Chromosome Location:
          Chr.14: 100307859 - 100307956 [+] on Build GRCh38
          Stem-loop Location:
          Chr.14: 100307859 - 100307956 [+] on Build GRCh38
          Mature miRNA ID:
          hsa-miR-345-3p hsa-miR-345-5p
          Species:
          Human
          Product Type:
          TaqMan™ Pri-miRNA Assay
          Assay ID Hs03303659_pri
          Size
          Availability Made To Order
          Catalog # 4427012
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Amplicon Length:

          74

          Chromosome Location:

          Chr. 14 - 100308257 - 100308257 [-] on 100308257 Build GRCh38

          Species:

          Human

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-345-3p MIMAT0022698
          Human hsa-miR-345-5p MIMAT0000772

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-345
          Stem-loop Accession # MI0000825
          Stem-loop Sequence
          ACCCAAACCCUAGGUCUGCUGACUCCUAGUCCAGGGCUCGUGAUGGCUGGUGGGCCCUGAACGAGGGGUCUGGAGGCCUGGGUUUGAAUAUCGACAGC
          Chromosome Location Chr. 14 - 100307859 - 100307956 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0022698
          miRBase ID: hsa-miR-345-3p
          Mature miRNA Sequence: GCCCUGAACGAGGGGUCUGGAG
          Chromosome Location: Chr. 14 - 100307859 - 100307956 [+] on Build GRCh38

          miRBase Accession #: MIMAT0000772
          miRBase ID: hsa-miR-345-5p
          Mature miRNA Sequence: GCUGACUCCUAGUCCAGGGCUC
          Chromosome Location: Chr. 14 - 100307859 - 100307956 [+] on Build GRCh38

          Gene Family ID MIPF0000189, mir-345
          Distance to Amplicon 263 bases

          Back To Top

          More Information




          Related Products

          Ambion® Anti-miR™ miRNA Inhibitor : AM24155
          Ambion® Pre-miR™ miRNA Precursor : PM24155
          TaqMan™ MicroRNA Assay : 474987_mat
          mirVana® miRNA inhibitor : MH24155
          mirVana® miRNA mimic : MC24155
          TaqMan™ Advanced miRNA Assay : 478833_mir
          Ambion® Anti-miR™ miRNA Inhibitor : AM12733
          Ambion® Pre-miR™ miRNA Precursor : PM12733
          TaqMan™ MicroRNA Assay : 002186
          mirVana® miRNA inhibitor : MH12733
          mirVana® miRNA mimic : MC12733
          TaqMan™ Advanced miRNA Assay : 478366_mir

          Back To Top

          Related Products

          • High Capacity RNA-to-cDNA Kit
          • SuperScript® IV VILO™ Master Mix
          • TaqMan® Universal PCR Master Mix
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Notice
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-blue-7fb9f846c9-l8rg4:80/100.66.76.64:80.
          git-commit: 8207b5afa5c305bd40e0a4f0b9b53fd46f2a8829
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.59.1-2026.09.91-1.0