Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Cell and Gene Therapy
    • Chromatography
    • Molecular Testing
    • Digital Solutions
    • DNA and RNA Extraction and Analysis
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • Unity Lab Services
    • See all services
  • Help and Support
    • How to Order
    • Instrument Support
    • Learning Centers
    • Register for an Account
    • Technical Support Centers
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Promotions
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Promos
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Connect: Lab, Data, Apps
            • Custom Products & Projects
            • Services Central
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › Hs03305430_pri
          Assay Name:
          hsa-mir-1237
          Stem-loop ID:
          hsa-mir-1237
          Mapped to miRBase Version:
          v22.1
          Chromosome Location:
          Chr.11: 64368602 - 64368703 [+] on Build GRCh38
          Stem-loop Location:
          Chr.11: 64368602 - 64368703 [+] on Build GRCh38
          Mature miRNA ID:
          hsa-miR-1237-5p hsa-miR-1237-3p
          Species:
          Human
          Product Type:
          TaqMan™ Pri-miRNA Assay
          Assay ID Hs03305430_pri
          Size
          Availability Made To Order
          Catalog # 4427012
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Amplicon Length:

          73

          Chromosome Location:

          Chr. 11 - 64368896 - 64368896 [-] on 64368896 Build GRCh38

          Species:

          Human

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-1237-5p MIMAT0022946
          Human hsa-miR-1237-3p MIMAT0005592

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-1237
          Stem-loop Accession # MI0006327
          Stem-loop Sequence
          GUGGGAGGGCCCAGGCGCGGGCAGGGGUGGGGGUGGCAGAGCGCUGUCCCGGGGGCGGGGCCGAAGCGCGGCGACCGUAACUCCUUCUGCUCCGUCCCCCAG
          Chromosome Location Chr. 11 - 64368602 - 64368703 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0022946
          miRBase ID: hsa-miR-1237-5p
          Mature miRNA Sequence: CGGGGGCGGGGCCGAAGCGCG
          Chromosome Location: Chr. 11 - 64368602 - 64368703 [+] on Build GRCh38

          miRBase Accession #: MIMAT0005592
          miRBase ID: hsa-miR-1237-3p
          Mature miRNA Sequence: UCCUUCUGCUCCGUCCCCCAG
          Chromosome Location: Chr. 11 - 64368602 - 64368703 [+] on Build GRCh38

          Gene Family ID MIPF0000585, mir-1237
          Distance to Amplicon 155 bases

          Back To Top

          More Information




          Related Products

          Ambion® Anti-miR™ miRNA Inhibitor : AM25699
          Ambion® Pre-miR™ miRNA Precursor : PM25699
          mirVana® miRNA inhibitor : MH25699
          mirVana® miRNA mimic : MC25699
          TaqMan™ Advanced miRNA Assay : 479550_mir
          Ambion® Anti-miR™ miRNA Inhibitor : AM13560
          Ambion® Pre-miR™ miRNA Precursor : PM13560
          TaqMan™ MicroRNA Assay : 002765
          mirVana® miRNA inhibitor : MH13560
          mirVana® miRNA mimic : MC13560
          TaqMan™ Advanced miRNA Assay : 477878_mir

          Back To Top

          Related Products

          • High Capacity RNA-to-cDNA Kit
          • SuperScript® IV VILO™ Master Mix
          • TaqMan® Universal PCR Master Mix
          • TaqMan® Fast Advanced Master Mix
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Unity Lab Services
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Information Center
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Spain flag icon
          Spain

          TEST

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline