Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › MC25699
          Assay Name: hsa-miR-1237-5p
          miRBase Accession Number: MI0006327
          miRBase Version: v22.1
          Chromosome Location: Chr.11: 64368602 - 64368703 [+] on Build GRCh38
          Mature miRNA Sequence: CGGGGGCGGGGCCGAAGCGCG
          Species: Human
          Product Type: mirVana® miRNA mimic
          Assay ID MC25699

          Purification
          Size
          Availability Made To Order
          Catalog # 4464066
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000585, mir-1237

          Mature miRNA Sequence:

          CGGGGGCGGGGCCGAAGCGCG

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-1237-5p MIMAT0022946

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-1237
          Stem-loop Accession # MI0006327
          Stem-loop Sequence
          GUGGGAGGGCCCAGGCGCGGGCAGGGGUGGGGGUGGCAGAGCGCUGUCCCGGGGGCGGGGCCGAAGCGCGGCGACCGUAACUCCUUCUGCUCCGUCCCCCAG
          Chromosome Location Chr. 11 - 64368602 - 64368703 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0022946
          miRBase ID: hsa-miR-1237-5p
          Mature miRNA Sequence: CGGGGGCGGGGCCGAAGCGCG
          Chromosome Location: Chr. 11 - 64368602 - 64368703 [+] on Build GRCh38


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03305430_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM25699
          Ambion® Pre-miR™ miRNA Precursor : PM25699
          mirVana® miRNA inhibitor : MH25699
          TaqMan™ Advanced miRNA Assay : 479550_mir

          Back To Top

          Related Products

          • Anti-GAPDH, Mouse Monoclonal 6C5
          • Anti-β-Actin, Mouse Monoclonal AC-15
          • TaqMan® Gene Expression Cells-to-CT™
          • Neon™ Transfection System 100 µL Kit
          • Lipofectamine™ RNAiMAX Transfection Reagent
          • Invivofectamine 2.0
          • Neon™ Transfection System
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          • Social Media
          • Contact Us
          • Report a Site Issue
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Argentina flag icon
          Argentina

          Your items have has been added!


          Host server : magellan-search-blue-67655d8755-b2k9d:80/100.66.79.173:80.
          git-commit: dddaa802cd395f65bf1581942d0e97a089c38f41
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.46.0-Offline