Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture and Transfection
    • Chemicals
    • Chromatography
    • Electron Microscopes
    • Lab Plasticware and Supplies
    • Lab Centrifuges
    • Lab Solutions
    • Mass Spectrometers
    • Next Generation Sequencers
    • See all product categories
  • Applications
    • Brands
    • Industrial and Applied Sciences
    • Food and Beverage
    • Forensics
    • Lab Solutions
    • Life Sciences
    • Pharma and Biopharma
    • Biotechnology
    • Clinical and Diagnostics
    • Digital Solutions
    • See all applications
  • Services
    • Lab Instrument and Equipment Services
    • Custom Services
    • Training Services
    • Financial and Leasing Services
    • Enterprise Level Lab Informatics
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Cell Biology Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • Contact Us
    • Product Documentation
    • Knowledge Base and Product FAQs
    • Learning Centers
    • Supply Center
    • eProcurement Solutions
    • Lab Instrument and Equipment Support
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › MC12614
          Assay Name: hsa-miR-518e-3p
          miRBase Accession Number: MI0003169
          miRBase Version: v22.1
          Chromosome Location: Chr.19: 53729838 - 53729925 [+] on Build GRCh38
          Mature miRNA Sequence: AAAGCGCUUCCCUUCAGAGUG
          Species: Human, Gorilla gorilla, Pan troglodytes, Pongo pygmaeus
          Product Type: mirVana® miRNA mimic
          Assay ID MC12614

          Purification
          Size
          Availability Made To Order
          Catalog # 4464066
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000020, mir-515

          Mature miRNA Sequence:

          AAAGCGCUUCCCUUCAGAGUG

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Human hsa-miR-518e-3p MIMAT0002861
          Gorilla gorilla ggo-miR-518e-3p MIMAT0036428
          Pan troglodytes ptr-miR-518e MIMAT0008190
          Pongo pygmaeus ppy-miR-518e-3p MIMAT0036451

          Stem-loop Details



          Human

          Stem-loop ID hsa-mir-518e
          Stem-loop Accession # MI0003169
          Stem-loop Sequence
          UCUCAGGCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGGCUAAAAGAAAAGAAAGCGCUUCCCUUCAGAGUGUUAACGCUUUGAGA
          Chromosome Location Chr. 19 - 53729838 - 53729925 [+] on Build GRCh38
          Mature MicroRNA miRBase Accession #: MIMAT0002861
          miRBase ID: hsa-miR-518e-3p
          Mature miRNA Sequence: AAAGCGCUUCCCUUCAGAGUG
          Chromosome Location: Chr. 19 - 53729838 - 53729925 [+] on Build GRCh38

          Gorilla gorilla

          Stem-loop ID ggo-mir-518e
          Stem-loop Accession # MI0031082
          Stem-loop Sequence
          CAAGAUCUCAGGCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGGCUAAAAGAAAAGAAAGCGCUUCCCUUCAGAGUGUUACGCUUUGAGAAAAGCA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0036428
          miRBase ID: ggo-miR-518e-3p
          Mature miRNA Sequence: AAAGCGCUUCCCUUCAGAGUG
          Chromosome Location: NA

          Pan troglodytes

          Stem-loop ID ptr-mir-518e
          Stem-loop Accession # MI0008716
          Stem-loop Sequence
          CUCAGGCUGUGACCCUCUAGAGGGAAGCGCUUUCUGUUGGCUAAAAGAAAAGAAAGCGCUUCCCUUCAGAGUGUUAACGCUUUGAGA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0008190
          miRBase ID: ptr-miR-518e
          Mature miRNA Sequence: AAAGCGCUUCCCUUCAGAGUG
          Chromosome Location: NA

          Pongo pygmaeus

          Stem-loop ID ppy-mir-518e
          Stem-loop Accession # MI0031104
          Stem-loop Sequence
          CUGGAGCAAGAAGAUCUCAUGAUGUGACCCCUCUAGAGGGAAGCACUUUCUGUUGGCUAAAAGAAAAAGAAAGCGCUUCCCUUCAGAGUGUUACGCUUUGAGAAAAGCA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0036451
          miRBase ID: ppy-miR-518e-3p
          Mature miRNA Sequence: AAAGCGCUUCCCUUCAGAGUG
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Hs03304060_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM12614
          Ambion® Pre-miR™ miRNA Precursor : PM12614
          TaqMan™ MicroRNA Assay : 002395
          mirVana® miRNA inhibitor : MH12614
          TaqMan™ Advanced miRNA Assay : 479408_mir


          miRBase Alias:

          Human: hsa-miR-518e (v17)
          Pongo pygmaeus: ppy-miR-518g-3p (v21)

          Back To Top

          Related Products

          • Anti-GAPDH, Mouse Monoclonal 6C5
          • Anti-β-Actin, Mouse Monoclonal AC-15
          • TaqMan® Gene Expression Cells-to-CT™
          • Neon™ Transfection System 100 µL Kit
          • Lipofectamine™ RNAiMAX Transfection Reagent
          • Invivofectamine 2.0
          • Neon™ Transfection System
          Ordering Plus Icon Minus Icon
          • Quick Order
          • eProcurement
          • Supply Center
          • Order Status
          • Chemicals
          • India Mobile App
          • Government eMarketplace
          Support Plus Icon Minus Icon
          • Order Support
          • Training
          • Contact Us
          • Report a Site Issue
          • Instrument Management
          Resources Plus Icon Minus Icon
          • Product Selection Guides
          • Mobile & Desktop Apps
          • Webinars
          • Blog 
          • Social Media
          • New Products
          • Promotions
          • Shared Lists
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          India flag icon
          India

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-n9r8p:80/100.66.76.150:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline