Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Antibodies
    • Cell Culture Media
    • Chemicals
    • Western Blot Products
    • Chromatography Columns and Cartridges
    • Lab Equipment
    • Lab Plasticware and Supplies
    • Microplates
    • Oligos, Primers, Probes and Genes
    • TaqMan Real-Time PCR Assays
    • Greener Products
    • See all product categories
  • Applications
    • Bioprocessing
    • Cell Culture and Transfection
    • Food and Beverage
    • Lab Solutions
    • Pharma and Biopharma
    • Real-Time PCR
    • Semiconductor Analysis
    • Clinical and Diagnostics
    • Digital Solutions
    • Spectroscopy, Elemental and Isotope Analysis
    • See all applications and techniques
  • Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Custom Services
    • Financial and Leasing Services
    • Instrument Services
    • Lab Informatics
    • OEM and Commercial Supply
    • Training Services
    • See all services
  • Help and Support
    • Order Help
    • Digital Solutions
    • Product Support
    • Technical Information
    • Training and Education
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Order Status and Tracking
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Order Status
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
            • Instrument Management
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › MC18078
          Assay Name: aae-miR-282-5p
          miRBase Accession Number: MI0013517
          miRBase Version: v22.1
          Chromosome Location: -
          Mature miRNA Sequence: AAUCUAGCCUCUCCUAGGCUUUGUCUG
          Species: Aedes aegypti
          Product Type: mirVana® miRNA mimic
          Assay ID MC18078

          Purification
          Size
          Availability Made To Order
          Catalog # 4464066
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000150, mir-282

          Mature miRNA Sequence:

          AAUCUAGCCUCUCCUAGGCUUUGUCUG

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Aedes aegypti aae-miR-282-5p MIMAT0014311

          Stem-loop Details



          Aedes aegypti

          Stem-loop ID aae-mir-282-1
          Stem-loop Accession # MI0013517
          Stem-loop Sequence
          AUCGUCAUCGUCAUCGUCGCACAGGUGUAAUCUAGCCUCUCCUAGGCUUUGUCUGUUACCUUCCUUGGGAAUUCCACUAGCCAGACAUAGCCUGACAGAGGUUAGGUGAAAUCUGAAAAGUCAACGGCCAACGGU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0014311
          miRBase ID: aae-miR-282-5p
          Mature miRNA Sequence: AAUCUAGCCUCUCCUAGGCUUUGUCUG
          Chromosome Location: NA

          Stem-loop ID aae-mir-282-2
          Stem-loop Accession # MI0013518
          Stem-loop Sequence
          AUCGUCAUCGUCAUCGUCGCACAGGUGUAAUCUAGCCUCUCCUAGGCUUUGUCUGUUACCUUCCUUGGGAAUUCCACUAGCCAGACAUAGCCUGACAGAGGUUAGGUGAAAUCUGAAAAGUCAACGGCCAACGGU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0014311
          miRBase ID: aae-miR-282-5p
          Mature miRNA Sequence: AAUCUAGCCUCUCCUAGGCUUUGUCUG
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ MicroRNA Assay : 244286_mat
          mirVana® miRNA inhibitor : MH18078


          miRBase Alias:

          Achromobacter aegrifaciens: aae-miR-282 (v18)

          Back To Top

          Related Products

          • Anti-GAPDH, Mouse Monoclonal 6C5
          • Anti-β-Actin, Mouse Monoclonal AC-15
          • TaqMan® Gene Expression Cells-to-CT™
          • Neon™ Transfection System 100 µL Kit
          • Lipofectamine™ RNAiMAX Transfection Reagent
          • Invivofectamine 2.0
          • Neon™ Transfection System
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Social Responsibility Social Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          Taiwan flag icon
          Taiwan

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-lnstr:80/100.66.74.145:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline