Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • New Products
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › MH10576
          Assay Name: rno-miR-143-3p
          miRBase Accession Number: MI0000916
          miRBase Version: v22.1
          Chromosome Location: Chr.18: 56971273 - 56971377 [-] on Build Rnor_6.0
          Mature miRNA Sequence: UGAGAUGAAGCACUGUAGCUCA
          Species: Rat, Daubentonia madagascariensis, Gorilla gorilla, Lagothrix lagotricha, Ophiophagus hannah, Pan paniscus, Pan troglodytes, Pongo pygmaeus
          Product Type: mirVana® miRNA inhibitor
          Assay ID MH10576

          Purification
          Size
          Availability Made To Order
          Catalog # 4464084
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Gene Family ID:

          MIPF0000094, mir-143

          Mature miRNA Sequence:

          UGAGAUGAAGCACUGUAGCUCA

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Rat rno-miR-143-3p MIMAT0000849
          Daubentonia madagascariensis dma-miR-143 MIMAT0049255
          Gorilla gorilla ggo-miR-143 MIMAT0002258
          Lagothrix lagotricha lla-miR-143 MIMAT0002260
          Ophiophagus hannah oha-miR-143-3p MIMAT0036724
          Pan paniscus ppa-miR-143 MIMAT0002261
          View More Rows
          Pan troglodytes ptr-miR-143 MIMAT0002257
          Pongo pygmaeus ppy-miR-143 MIMAT0002259

          Stem-loop Details



          Rat

          Stem-loop ID rno-mir-143
          Stem-loop Accession # MI0000916
          Stem-loop Sequence
          GCGGAGCGCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGGGAGAAGAUGUUCUGCAGC
          Chromosome Location Chr. 18 - 56971273 - 56971377 [-] on Build Rnor_6.0
          Mature MicroRNA miRBase Accession #: MIMAT0000849
          miRBase ID: rno-miR-143-3p
          Mature miRNA Sequence: UGAGAUGAAGCACUGUAGCUCA
          Chromosome Location: Chr. 18 - 56971273 - 56971377 [-] on Build Rnor_6.0

          Daubentonia madagascariensis

          Stem-loop ID dma-mir-143
          Stem-loop Accession # MI0039983
          Stem-loop Sequence
          AGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0049255
          miRBase ID: dma-miR-143
          Mature miRNA Sequence: UGAGAUGAAGCACUGUAGCUCA
          Chromosome Location: NA

          Gorilla gorilla

          Stem-loop ID ggo-mir-143
          Stem-loop Accession # MI0002550
          Stem-loop Sequence
          GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0002258
          miRBase ID: ggo-miR-143
          Mature miRNA Sequence: UGAGAUGAAGCACUGUAGCUCA
          Chromosome Location: NA

          Lagothrix lagotricha

          Stem-loop ID lla-mir-143
          Stem-loop Accession # MI0002552
          Stem-loop Sequence
          GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0002260
          miRBase ID: lla-miR-143
          Mature miRNA Sequence: UGAGAUGAAGCACUGUAGCUCA
          Chromosome Location: NA

          Ophiophagus hannah

          Stem-loop ID oha-mir-143
          Stem-loop Accession # MI0031356
          Stem-loop Sequence
          CCCAAGGUGCAGUGCUGCAUCUCUGGUCAGUUGUGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGGG
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0036724
          miRBase ID: oha-miR-143-3p
          Mature miRNA Sequence: UGAGAUGAAGCACUGUAGCUCA
          Chromosome Location: NA

          Pan paniscus

          Stem-loop ID ppa-mir-143
          Stem-loop Accession # MI0002553
          Stem-loop Sequence
          GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUUUUCUGCAGC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0002261
          miRBase ID: ppa-miR-143
          Mature miRNA Sequence: UGAGAUGAAGCACUGUAGCUCA
          Chromosome Location: NA

          Pan troglodytes

          Stem-loop ID ptr-mir-143
          Stem-loop Accession # MI0002549
          Stem-loop Sequence
          GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUUUUCUGCAGC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0002257
          miRBase ID: ptr-miR-143
          Mature miRNA Sequence: UGAGAUGAAGCACUGUAGCUCA
          Chromosome Location: NA

          Pongo pygmaeus

          Stem-loop ID ppy-mir-143
          Stem-loop Accession # MI0002551
          Stem-loop Sequence
          GCGCAGCGCCCUGUCUCCCAGCCUGAGGUGCAGUGCUGCAUCUCUGGUCAGUUGGGAGUCUGAGAUGAAGCACUGUAGCUCAGGAAGAGAGAAGUUGUUCUGCAGC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0002259
          miRBase ID: ppy-miR-143
          Mature miRNA Sequence: UGAGAUGAAGCACUGUAGCUCA
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          TaqMan™ Pri-miRNA Assay : Rn03466026_pri
          Ambion® Anti-miR™ miRNA Inhibitor : AM10576
          Ambion® Pre-miR™ miRNA Precursor : PM10576
          TaqMan™ MicroRNA Assay : 000466
          mirVana® miRNA mimic : MC10576
          TaqMan™ Advanced miRNA Assay : rno480935_mir


          miRBase Alias:

          Rat: rno-miR-143 (v18)

          Back To Top

          Related Products

          • Anti-GAPDH, Mouse Monoclonal 6C5
          • Anti-β-Actin, Mouse Monoclonal AC-15
          • TaqMan® Gene Expression Cells-to-CT™
          • Neon™ Transfection System 100 µL Kit
          • Lipofectamine™ RNAiMAX Transfection Reagent
          • Invivofectamine 2.0
          • Neon™ Transfection System
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-79565875f6-vjw2z:80/100.66.77.38:80.
          git-commit: 280dcbe45276d5d6e613c14d399020b8a49b7116
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.57.0-Offline