Hamburger Menu Button
Thermo Fisher Scientific Logo
Sign in
Don't have an account ? Create Account
  • Products
    • Cell Analysis
    • Antibodies
    • Mass Spectrometry
    • Cell Culture
    • Laboratory Instruments
    • Clinical and Diagnostics
    • Chromatography
    • Laboratory Equipment
    • Laboratory Supplies
    • Molecular Biology and Nucleic Acid Analysis
    • Sequence-Specific Nucleic Acid Products
    • See all product categories
  • Applications
    • Cell Culture and Transfection
    • Flow Cytometry
    • Cancer Research
    • Chromatography
    • Sequencing
    • PCR
    • Lab Solutions
    • Allergy Diagnostics
    • See all applications and techniques
  • Services
    • Cell Biology Services
    • Custom Services
    • Training Services
    • Lab Informatics Services
    • Financial and Leasing Services
    • Partnering and Licensing Services
    • 360° CDMO and CRO Solutions
    • CDMO Services
    • CRO Services
    • Food Safety Inspection Services
    • See all services
  • Help and Support
    • How to Order
    • Promotions and Online Offers
    • Contact Us
    • Change Location
    • Create a New Account
    • See all help and support topics
  • Popular
    • TaqMan Real-Time PCR Assays
      TaqMan Real-Time PCR Assays
    • Antibodies
      Antibodies
    • Oligos, Primers & Probes
      Oligos, Primers & Probes
    • GeneArt Gene Synthesis
      GeneArt Gene Synthesis
    • Cell Culture Plastics
      Cell Culture Plastics
  • Who We Serve
    • Biotech
    • Biopharma
    • CDMO
    • Lab Diagnostics
    • Industrial and Applied Sciences
  • Special Offers
  • Contact Us
  • Quick Order
  • Documents and Certificates
Thermo Fisher Scientific Logo

Search

Search All
Search button
          • Contact Us
          • Quick Order
          • Sign in
            Sign in
            Don't have an account ? Create Account
            • Account
            • Check Order Status
            • Custom Products & Projects
          This product has been added to your favorites list. Go to My Favorites

          System Message

          OKCancel
          LOADING ...
          • Home
          • › Search Tool
          • › Search Results
          • › MH37290
          Assay Name: abu-miR-7147
          miRBase Accession Number: MI0033972
          miRBase Version: v22.1
          Chromosome Location: -
          Mature miRNA Sequence: UGUACCAUGCUGGUAGCCAGUG
          Species: Astatotilapia burtoni, Metriaclima zebra, Neolamprologus brichardi, Oreochromis niloticus, Pundamilia nyererei
          Product Type: mirVana® miRNA inhibitor
          Assay ID MH37290

          Purification
          Size
          Availability Made To Order
          Catalog # 4464084
          Price
          Your Price
          Online offer:
          Check your price ›
          • Genomic Map
          • Assay Details
          • More Information

          Genomic Map

          LOADING...
          ×
          Back To Top

          Assay Details

          Mature miRNA Sequence:

          UGUACCAUGCUGGUAGCCAGUG

          miRBase Details:



          Species miRBase ID miRBase Accession Number
          Astatotilapia burtoni abu-miR-7147 MIMAT0042237
          Metriaclima zebra mze-miR-7147 MIMAT0042452
          Neolamprologus brichardi nbr-miR-7147 MIMAT0042636
          Oreochromis niloticus oni-miR-7147 MIMAT0042845
          Pundamilia nyererei pny-miR-7147 MIMAT0043026

          Stem-loop Details



          Astatotilapia burtoni

          Stem-loop ID abu-mir-7147
          Stem-loop Accession # MI0033972
          Stem-loop Sequence
          UGUACCAUGCUGGUAGCCAGUGUGUGGUAGGCUUUGCUGGUGACCAGCGUUGUGCCU
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0042237
          miRBase ID: abu-miR-7147
          Mature miRNA Sequence: UGUACCAUGCUGGUAGCCAGUG
          Chromosome Location: NA

          Metriaclima zebra

          Stem-loop ID mze-mir-7147
          Stem-loop Accession # MI0034256
          Stem-loop Sequence
          UGUACCAUGCUGGUAGCCAGUGUGUGGUAGGCUUUGCUGGUGACCAGCGUUGUGCCUC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0042452
          miRBase ID: mze-miR-7147
          Mature miRNA Sequence: UGUACCAUGCUGGUAGCCAGUG
          Chromosome Location: NA

          Neolamprologus brichardi

          Stem-loop ID nbr-mir-7147
          Stem-loop Accession # MI0034512
          Stem-loop Sequence
          UGUACCAUGCUGGUAGCCAGUGUGUGGUAGGCUUUGCUGGUGACCAGCGUUGUGCCUC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0042636
          miRBase ID: nbr-miR-7147
          Mature miRNA Sequence: UGUACCAUGCUGGUAGCCAGUG
          Chromosome Location: NA

          Oreochromis niloticus

          Stem-loop ID oni-mir-7147
          Stem-loop Accession # MI0034783
          Stem-loop Sequence
          UGUACCAUGCUGGUAGCCAGUGUGUGGUAGGCUUUGCUGGUGACCAGCGUUGUGCCUCA
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0042845
          miRBase ID: oni-miR-7147
          Mature miRNA Sequence: UGUACCAUGCUGGUAGCCAGUG
          Chromosome Location: NA

          Pundamilia nyererei

          Stem-loop ID pny-mir-7147
          Stem-loop Accession # MI0035029
          Stem-loop Sequence
          UGUACCAUGCUGGUAGCCAGUGUGUGGUAGGCUUUGCUGGUGACCAGCGUUGUGCCUC
          Chromosome Location -
          Mature MicroRNA miRBase Accession #: MIMAT0043026
          miRBase ID: pny-miR-7147
          Mature miRNA Sequence: UGUACCAUGCUGGUAGCCAGUG
          Chromosome Location: NA


          Back To Top

          More Information




          Related Products

          mirVana® miRNA inhibitor : MH37227
          mirVana® miRNA inhibitor : MH37437
          mirVana® miRNA inhibitor : MH37333
          mirVana® miRNA inhibitor : MH37387
          mirVana® miRNA mimic : MC37387
          mirVana® miRNA mimic : MC37290
          mirVana® miRNA mimic : MC37333
          mirVana® miRNA mimic : MC37227
          mirVana® miRNA mimic : MC37437

          Back To Top

          Related Products

          • Anti-GAPDH, Mouse Monoclonal 6C5
          • Anti-β-Actin, Mouse Monoclonal AC-15
          • TaqMan® Gene Expression Cells-to-CT™
          • Neon™ Transfection System 100 µL Kit
          • Lipofectamine™ RNAiMAX Transfection Reagent
          • Invivofectamine 2.0
          • Neon™ Transfection System
          Ordering Plus Icon Minus Icon
          • Order Status
          • Order Help
          • Quick Order
          • Supply Center
          • eProcurement
          Support Plus Icon Minus Icon
          • Help and Support
          • Contact Us
          • Technical Support Centers
          • Documents and Certificates
          • Report a Site Issue
          Resources Plus Icon Minus Icon
          • Learning Centers
          • Promotions
          • Events and Webinars
          • Social Media
          About Thermo Fisher Plus Icon Minus Icon
          • About Us About Us
          • Careers Careers
          • Investors Investors
          • News News
          • Responsibility Responsibility
          • Trademarks
          • Policies and Notices
          Our Portfolio Plus Icon Minus Icon
          • Thermo Scientific
          • Applied Biosystems
          • Invitrogen
          • Gibco
          • Ion Torrent
          • Fisher Scientific
          • Patheon
          • PPD
          • Terms & Conditions
          • Privacy Policy
          • Price & Freight Policy
          © 2006-2026 Thermo Fisher Scientific Inc. All rights reserved. All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified.
          México flag icon
          México

          Your items have has been added!


          Host server : magellan-search-green-b49b87d85-lnstr:80/100.66.74.145:80.
          git-commit: 5b8c860b7cdb41e9cfe07630520f6b51e109d38e
          git-url: https://github.com/thermofisher/magellan-search
          git-branch: release/2.47.0-Offline